Labshake search
Citations for Takara Bio :
1451 - 1500 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: The commercially available Cellartis Human iPS Cell Line 12 (Takara Bio Inc., Kusatsu, Japan) was used as the human iPS Cell line ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA from the human brain (#636530) and testis (#636533) was purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... was generated by PCR amplification of human S1R gene (www.ncbi.nlm.nih.gov/nuccore/NM_005866.3) and cloning into pEGFP-N2 vector (Clontech) using HindIII/XbaI cloning sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The HB-EGF cDNA was obtained from the Human Brain Matchmaker cDNA library (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... HEC1 and BUBR1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B55α was PCR amplified from HUVEC cDNA and cloned into pEGFP-C1 (Clontech) using HindIII and BamHI sites ...
-
bioRxiv - Biophysics 2022Quote: The coding sequence of human PAC (NP_060722) previously subcloned into pIRES2-EGFP vector (Clontech) using XhoI and EcoRI restriction enzyme sites9 was used for whole-cell patch clamp recording ...
-
bioRxiv - Molecular Biology 2024Quote: The human embryonic kidney (HEK) 293T cell line was purchased from Takara (Cat# 632180) and cultured in a humidified 95% air / 5% CO2 incubator at 37°C in a standard Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-tagged human tauKQ and tauP301L were expressed from the pEGFP-C1 plasmid (Clontech). Expression of mApple or GFP in cultured neurons was done using pGW1 mApple and pEGFP-C1 plasmids ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: Human DHRS7 was expressed as a GFP fusion using the pEGFP-N2 vector (Clontech) generated previously [5] ...
-
bioRxiv - Synthetic Biology 2023Quote: Human Embryonic Kidney (HEK) 293 cells (ATCC, CRL-1573) and HEK293T-LentiX (Takara Biosciences) were cultured in standard culture conditions (37ºC and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human CXCR4 was cloned into the pAcGFPm-N1 plasmid (Clontech Laboratories, Palo Alto, CA), as described (20).
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Cell Biology 2022Quote: ... and complementary DNA of miR was synthesized using the Mir-X miRNA First-Strand Synthesis Kit (TaKaRa). RT-qPCR was performed with TB Green Premix Ex Taq II (Tli RNaseH Plus ...
-
bioRxiv - Genomics 2020Quote: ... The titer of each virus was determined using the Lenti-X Go-Stix Plus kit (Takara Bio), according to the manufacturer’s instruction.
-
bioRxiv - Immunology 2019Quote: ... and the pool of viral particles was concentrated using Lenti-X concentrator (Clontech Laboratories; cat. no. 631231). The titer of the GXMR-CAR viral particles was determined using HEK-293FT cells ...
-
bioRxiv - Immunology 2019Quote: ... Viral titers were measured by a kit (Lenti-X p24 Rapid titer kit, #632200. Takara, Kusatsu, Japan). To suppress Mul1 expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... at a ratio of 2.5:1.0:0.6:0.5 to Lenti-X 293T cells (Takara, 632180, Kusatsu, Japan). A transfection reagent ...
-
bioRxiv - Neuroscience 2020Quote: ... The lentiviral genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Neuroscience 2021Quote: ... filtered through Whatman 0.45μm CA filter (GE #10462100) and concentrated using Lenti-X™ Concentrator (Takara #631232) according to the producer instructions (overnight incubation) ...
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... The approximate titer of lentivirus was evaluated using a lentiviral titration kit (Lenti-X GoStix Plus; ClonTech). The lentiviral medium was transferred to 50 mL centrifuge tubes ...
-
bioRxiv - Cell Biology 2021Quote: ... and checked for the presence of infectious virons by applying a sample to Lenti-X GoStix (Clontech). When cells reached 50% confluence ...
-
bioRxiv - Cell Biology 2021Quote: A549 cells (purchased from JCRB cell bank, Japan (JCRB0076)) and Lenti-X 293T cells (Takara Bio, Japan) were cultured in high-glucose Dulbecco’s modified Eagle’s media (DMEM ...
-
bioRxiv - Microbiology 2022Quote: ... the supernatant was collected and concentrated by Lenti-X™ Concentrator following the manufactures protocol (Clontech, CA). The pellet was resuspended in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... LASVpp-BlaM virus was concentrated 10 times with Lenti-X concentrator (Clontech Laboratories, Mountain View, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2019Quote: Virus titer was determined by quantitative Polymerase Chain Reaction (qPCR) using Adeno-X qPCR Titration Kit (Clontech) on an Applied Biosystems 7900HT.
-
bioRxiv - Microbiology 2020Quote: ... The purified virus was titrated with Lenti-X p24 Rapid Titer Assay (Takara Bio, Cat. No. 632200). The virus was stored at -80 °C for future use.
-
bioRxiv - Neuroscience 2020Quote: ... Viral titer was determined using a qPCR Lentivirus Titration Kit (Lenti-X, qRT-PCR Titration Kit, Takara). For smaller scale virus preparation ...