Labshake search
Citations for Takara Bio :
1351 - 1400 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the human cytomegalovirus (hCMV) promoter/immediate-early enhancer (IE) of peGFP-N1 (Clontech) and the chimeric intron (chI ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA pools from human brain (cat. no. 636530, Takara Bio USA, Inc), small intestine (cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cloning of the human SIK2 coding sequence to the pEGFP-C3 (Clontech, USA) vector was previously described by Küser-Abali et al. ...
-
bioRxiv - Neuroscience 2024Quote: The primary human fibroblasts (HFs) and the corresponding iPSCs were purchased from Takara Bio (Kusatsu ...
-
bioRxiv - Neuroscience 2023Quote: Human neurons were transfected on DIV28 with pEGFP-C1 (0.3 μg/well, Clontech) plus vectors expressing mCherry ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Microbiology 2019Quote: ... and then prehybridized in 5 mL ExpressHyb (ClonTech) for 1 hour at 65°C ...
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Cell Biology 2019Quote: ... and both proteins were separated from each other and from a protein encoded by blasticidin resistance gene (cloned from pQCXIB #631516, Clontech) by self-cleavage peptide P2A ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eukaryotic expression vectors encoding green fluorescent protein (GFP)-tagged proteins were generated by inserting PCR-amplified fragments into pd1-EGFP-N1 vector (6073-1, Clontech). Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01 ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were collected and mixed with Laemmli buffer after measuring the protein concentration using a TaKaRa BCA Protein Assay Kit (TaKaRa). Samples were subjected to SDS-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Biophysics 2024Quote: ... The concentration of purified proteins was determined by the Bradford method using TaKaRa Bradford Protein Assay Kit (Takara Bio, T9310A).
-
bioRxiv - Biochemistry 2020Quote: ... Lentivirus particles were generated using the Lenti-X Single Shot system (ClonTech, Mountain View, CA, US) in 293T-Lenti-X cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 μL of PBS including 0.2% Triton X-100 and 4U of RNase inhibitor (Takara) per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was collected at 48 hours and 72 hours and concentrated with Lenti-X Concentrator (Clontech). The Virus was resuspended in DMEM and stored at -80C.
-
bioRxiv - Developmental Biology 2020Quote: ... We collected viral media at 24 and 48 hours and concentrated using Lenti-X Concentrator (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... LV particles were concentrated from the filtered supernatants using a Lenti-X concentrator kit (Takara, 631232) following manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2022Quote: ... a lentiviral approach was developed using the Lenti-X Tet-On 3G Inducible Expression System (Clontech). The ORF encoding Fgfr2iiib (Origene ...
-
bioRxiv - Cell Biology 2019Quote: ... after which virus-containing supernatants were harvested and concentrated ∼40-fold using Lenti-X Concentrator (Clontech) per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and sterile filtered before being concentrated with Lenti-X Concentrator (631232,Takara Bio, Kusatsu, Shiga, Japan). Concentrated virus was resuspended in 200µL 1xPBS per well created ...
-
bioRxiv - Genomics 2021Quote: ... The dCas9KRAB lentivirus was concentrated 20X the initial media volume using Lenti-X concentrator (Clontech, 631232), following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... but before cell application lentivirus was concentrated using the Lenti-X Concentrator kit (Takara Bio #631232) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and then concentrated using the lenti-x concentrator (Cat. No. 631231, Clontech Laboratories, Mountain View, CA).