Labshake search
Citations for Takara Bio :
1501 - 1550 of 2435 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... inducible cell lines were generated using the Lenti-X Tet-On-Advanced Inducible Expression System (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... filtered through Whatman 0.45 µm CA filter (GE #10462100) and concentrated using Lenti-X™ Concentrator (Takara #631232) according to producer datasheet (overnight incubation) ...
-
X-ray mediated scintillation increases synaptic activity via Cerium-doped LSO and Channelrhodopsin-2bioRxiv - Neuroscience 2020Quote: ... showing a viral titer of >106 IFU/ml as measured by Lenti-X GoStix (Takara, Mountain View, CA). To develop stably expressing OptoXR-EYFP cells ...
-
bioRxiv - Cell Biology 2022Quote: ... achieving 10x concentrated preparations of which the lentiviral titer was determined using Lenti-X GoStix Plus (Takara, 631280). Lentiviral preparations were aliquoted and stored at -80°C until use.
-
Increased ACTL6A Occupancy Within mSWI/SNF Chromatin Remodelers Drives Human Squamous Cell CarcinomabioRxiv - Molecular Biology 2021Quote: ... together with packaging vectors pMD2.G (4.5 μg) and psPAX2 (13.5 μg) were delivered into lenti-X 293T cells (Clontech) using 108-144 μg PEI MAX 40K (Polysciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus was collected in the supernatant and filtered prior to concentrating with Lenti-X™ Concentrator (Clontech 631231) manufacturer protocol.
-
bioRxiv - Immunology 2021Quote: ... Viral supernatant was collected and concentrated using Lenti-X Concentrator 24- and 48-hours after the transfection (Clontech). Jurkat 76.7 cells (a gift from Wouter Scheper ...
-
bioRxiv - Neuroscience 2022Quote: All viruses were made using the 2nd generation lentiviral packaging systems in Lenti-X HEK293 FTT cells (Takara). Lenti-X cells were passaged maximum 3 times before being used for virus production in HEK media (High glucose DMEM with 4 mM GlutaMAX ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral containing supernatant was collected at 96 hr post transfection and concentrated using Lenti-X concentrator (Takara; 631232). Collected lentivirus was tittered using Lenti-X™ GoStix™ Plus (Takara;631280) ...
-
bioRxiv - Cancer Biology 2022Quote: ... with lentivirus for 8h at an optimized dilution determined with the Lenti-X GoStix Plus protocol (Takara, 631280). CHAC1 and SLC25A39 knockout cells were generated using the pLenti-CRISPR-V2 plasmid (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... and either used on the same day or concentrated using Lenti-X concentrator solution (Takara Bio, Cat #631231) and snap frozen at −80C.
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Neuroscience 2022Quote: ... Media containing viral particles was sterile-filtered and concentrated using the Lenti-X™ Concentrator (Takara Bio, 631231), according to manufacturer instructions.
-
bioRxiv - Neuroscience 2023Quote: ... Lentiviral supernatant was filtered through a 0.45 µm filter and concentrated using Lenti X Concentrator (Takara Bio, 631232) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The viral supernatants were collected 72 hr after transfection followed by virus concentration using Lenti-X concentrator (TaKaRa). Virus containing media was added to ATG3 KO HeLa cells with 8 μg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Biophysics 2023Quote: U2OS (a kind gift from Mark Groudine lab, Fred Hutchinson Cancer Research Center) and Lenti-X 293T (Takara) cells were cultured in a growth medium consisting of Dulbecco’s modified Eagle’s medium (GIBCO) ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... media containing lentivirus was collected and concentrated 100-fold using the Lenti-X Concentrator (Takara Bio, Cat# 631231). Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (abm ...
-
bioRxiv - Biophysics 2023Quote: ... The virus of each construct was produced in Lenti-X™ 293 T Cell Line (Takara, Cat. #632180) and previously described74 ...
-
bioRxiv - Biophysics 2023Quote: ... Insoluble material was then removed by centrifugation at 50k x g for 30 min and Talon resin (Clontech) with 20 mM imidazole was added to bind the expressed receptors overnight at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... A stable IFN-λ-expressing cell line was obtained by transfection of one million Lenti-X (HEK293T, Takara) cells with 500 ng Super PiggyBac Transposase vector and 1250 ng of PiggyBac transposase mammalian expression vector using Lipofectamine 3000 following to the manufactureŕs instructions ...
-
bioRxiv - Physiology 2024Quote: ... Three volumes of concentrated virus medium were subsequently mixed with one volume of Lenti-X concentrator (Takara Bio) and rotated at 4°C overnight before centrifugation (1500 g for 45 min at 4°C) ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus containing media was collected from the LentiX-293T cells and concentrated using Lenti-X Concentrator (Takara Bio). pLVX-Tet3G virus and polybrene was added to L6-myoblast cells and cells were positively selected using neomycin to create Tet3G expressing cells ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Cell Biology 2023Quote: ... the media was collected and viral particles were concentrated using Lenti-X™ Concentrator (Takara Bio Inc., 631231). For transduction ...
-
bioRxiv - Plant Biology 2023Quote: ... These plasmids were transformed into the yeast strain AH109 for testing protein-protein interaction using the Matchmaker Gold system (Takara Bio, Kusatsu, Japan). Yeast transformation and growth were performed as described in [Pecher et al. ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were incubated with TALON beads (Clontech) pre-equilibrated with purification buffer at RT for 1.5 h with overhead rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... the proteins were purified by TALON Metal Affinity Resin (Clontech) and filtered with Amicon Ultra 0.5ml (30K ...
-
bioRxiv - Synthetic Biology 2021Quote: ... concentrated proteins were determined those concentrations with Bradford (Takara Bio) or BCA (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...