Labshake search
Citations for Qiagen :
451 - 500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: Cells were lysed with Buffer RLT Plus (Qiagen) containing 1% beta-mercaptoethanol (Sigma) ...
-
bioRxiv - Genomics 2024Quote: ... cells were lysed with buffer RLT Plus (Qiagen) containing 1% beta-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... Total liver RNA was isolated by phenol-chloroform extraction and purified using the RNeasy Mini Kit (Qiagen, #74104). qPCR was performed as described below ...
-
bioRxiv - Neuroscience 2024Quote: RNA from hippocampal cultures or tissue was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) with extra DNase I digestion on the column ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by gel extraction using QIAEX II reagents (Qiagen). Libraries were quantified and quality checked using the Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated using RNeasy Plus kit (Qiagen, USA). RNA quality and concentration were determined using NanoDrop 2000 system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AllStars negative-control siRNA from Qiagen was used as control siRNA.
-
bioRxiv - Cancer Biology 2024Quote: ... The DNA was finally purified with the QIAquick PCR Purification kit (QIAGEN), resuspended in 200 µL of water ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using the RNeasy Kit (Qiagen); library generation and subsequent sequencing was performed by the clinical genomics lab (CGL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then harvested for RNA isolation using the RNeasy Mini Kit (Qiagen). Synthesis of complementary DNAs (cDNAs ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted using the RNeasy Mini kit (Qiagen, 74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total mRNA was cleaned up using RNeasy columns (Qiagen). HUVEC mRNA samples were submitted to the Institute for Research in Immunology and Cancer (IRIC ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total mRNA was cleaned up using RNeasy columns (Qiagen) and on-column DNase I treatment was performed using the RNase-Free DNase set (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and on-column DNase I treatment was performed using the RNase-Free DNase set (Qiagen). Tumor mRNA samples were submitted to the Montreal Clinical Research Institute (IRCM ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was collected with RNeasy Kit according the manufacturer’s instructions (#74104, Qiagen, Germantown, MD) and purity was validated using a 2100 Bioanylyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: DNA was isolated from cells using QiaAMP Blood Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was filtered through a 0.45 µm syringe filter and applied to a 5 ml Ni-NTA agarose column (Qiagen) pre-equilibrated in Lysis-Wash buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... They produced milligram amounts and were purified to >95% using immobilized Ni-NTA chromatography (Qiagen) from a periplasmic extract of a 1 L culture ...
-
bioRxiv - Biochemistry 2024Quote: ... The solution was applied to a column of 5 ml Ni-NTA agarose (Qiagen) equilibrated in Lysis-Wash buffer and the flow-through collected ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR-amplified templates were purified using QIAquick or MinElute PCR Purification Kits (Qiagen) and used for run-off in-vitro transcription (IVT).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Total RNA was purified with RNeasy Lipid Tissue Mini Kit (Qiagen). Libraries were generated with the Illumina® Stranded Total RNA Prep ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s instructions and a 529-bp repeat element in the T ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: Microdissected hippocampi were disrupted with ultra-turrax® in ice-cold QIAzol Lysis Reagent (Qiagen). Total RNA was purified with RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... The clear supernatant was later incubated with Ni-NTA resin (Qiagen, 30250) for 3 h ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant was loaded onto Ni-NTA beads (QIAGEN #30230) and eluted using 250 mM imidazole ...
-
bioRxiv - Biochemistry 2024Quote: Total RNAs were purified using the RNeasy Mini Kit (QIAGEN, #74134). First-strand cDNA was synthesized from purified RNA (1 µg ...
-
bioRxiv - Biochemistry 2024Quote: ... and purified using a QIAquick Gel Extraction Kit (Qiagen). The forward PCR primer (5’-GAAAAACTGGATCGTCTGAAAGCCCGGGCTTAAGGATAAGAACTAACGTGATTCC GGGGATCCGTCGACC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... RNAse A lysis buffer was prepared from IP buffer but is supplemented with 80 μg/mL of RNase A (Qiagen). Cells were gently resuspended and incubated for 30 minutes rocking on a tube rotator at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Genomic DNA was isolated using the Blood and Tissue Kit (Qiagen, 69506) according to the vendor’s recommendations ...
-
bioRxiv - Biochemistry 2024Quote: Total RNA was purified with RNeasy plus mini kit (Qiagen, Hilden, Germany). Complementary DNA was synthesized by High Capacity cDNA Reverse Transcription Kits (Applied Biosystems ...
-
bioRxiv - Biophysics 2024Quote: ... using the Rotor-Gene Q (Qiagen). Lastly ...
-
bioRxiv - Cancer Biology 2024Quote: Ingenuity Pathway Analysis (IPA, QIAGEN)80 was used to analyse the core pathways ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA was concentrated and purified using the Gel Extraction Kit from Qiagen (Hilden, DE). Lastly ...
-
bioRxiv - Cancer Biology 2024Quote: ... Integrative clinical sequencing was performed using standard approved protocols in the MCTP Clinical Laboratory Improvement Amendments-compliant sequencing laboratory as previously described.40,102,104 Total RNA purified using the AllPrep DNA/RNA/miRNA kit (Qiagen) was then sequenced using the exome-capture transcriptome platform on an Illumina HiSeq 2000 or HiSeq 2500 in paired-end mode ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from cDCs using the miRNeasy mini kit with the inclusion of the genomic DNA digestion step with the RNase-free DNase Kit (Qiagen). RNA quality was assessed by the Bioanalyzer RNA Nano Chip and depletion of rRNA prior to library generation was performed using RiboErase selection kit (Cat.# KK8561 ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated from cell pellets with RNeasy Micro purification kit (Qiagen, 74104) and digested with DNaseI (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2024Quote: ... After the separation of nanodiscs and soluble proteins on Ni-NTA (Qiagen), the same proportions of unbound material and imidazole-eluted material were analyzed (Fig.S5) ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-Strep (Qiagen, 34850, 1:1000 dilution) antibodies ...
-
bioRxiv - Biochemistry 2024Quote: ... Anti-Strep (Qiagen, 34850), Goat anti-mouse HRP-coupled secondary antibody (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were incubated with Ni-NTA beads (Qiagen) for 60 min at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by cation exchange chromatography using Source 15S Resin (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with NiNTA agarose (Qiagen). The eluate was further purified over a Source 15 Q column (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by cation exchange chromatography using Source 15S Resin (Cytiva) ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with Ni-NTA Agarose Resin (Qiagen), followed by affinity-purification with amylose resin (New England Biolabs) ...
-
bioRxiv - Biochemistry 2024Quote: ... Ni-NTA silica beads were purchased from Qiagen (Hilden, Germany). Evotips were purchased from Evosep (Odense ...
-
bioRxiv - Biochemistry 2024Quote: ... Initial crystals were obtained via sitting drop vapor diffusion from the PEGs Suite (Qiagen) in 96 well plates and optimized with hanging drop vapor diffusion in 24 well plates ...
-
bioRxiv - Biochemistry 2024Quote: ... 30 min) and supernatant was loaded onto a 1 ml Ni-NTA Superflow column (Qiagen). Proteins were eluted by an increasing imidazole gradient according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... genomic DNA was isolated using a DNeasy kit (QIAGEN). Indels were identified by PCR of the region of interest (Tables S3) ...
-
bioRxiv - Bioengineering 2024Quote: ... and DNA was purified using the DNeasy Blood & Tissue Kit (Qiagen, Cat. No. 69506) following the manufacturer’s protocol ...