Labshake search
Citations for Qiagen :
701 - 750 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: RNAs were isolated using RNeasy Plus RNA isolation kit (Qiagen) and additionally purified of DNA contamination using DNA-free kit (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... CCGGTTAGTGTTCGGGTGAAA (Qiagen, no. SI00912772).
-
bioRxiv - Cell Biology 2024Quote: ... AATTCTCCGAACGTGTCACGT (Qiagen, no. 1027281); Inf2 ...
-
bioRxiv - Cell Biology 2024Quote: ... CACGTAGAACTCCCTGCATAA (Qiagen, no. SI00912765); Sun2 #2 ...
-
bioRxiv - Cell Biology 2024Quote: ... TAGGCTCTAGGGAACAAATAA (Qiagen, no. SI00822031); Sun2 #1 ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from oocysts of transgenic parasites using the QIAGEN DNeasy Blood and Tissue Kit (QIAGEN, Germany). PCR primers were designed to anneal outside the 5′ and 3′ homology arms directing homologous recombination ...
-
bioRxiv - Microbiology 2024Quote: ... The released genomic DNA was amplified using the REPLI-g Single Cell Kit (QIAGEN) and analyzed by PCR targeting three genes that were polymorphic between the IIdA19G1-GD and IIdA20G1-HLJ isolates ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from the purified oocysts using the Qiagen DNA Mini Kit and amplified using the REPLI-g Midi Kit (QIAGEN). WGA products were purified using the EasyPure PCR Purification Kit (TransGen Biotech ...
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA was removed using QIAseq FastSelect –5S/16S/23S kit (Qiagen). Sequencing libraries were prepared with the KAPA Stranded RNA-Seq Library Preparation Kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The RNeasy Mini Kit (Qiagen) was used to extract and purify RNA from the cell pellets per vendor protocol ...
-
bioRxiv - Microbiology 2024Quote: ... including on-columns RNase-Free DNase treatment (Qiagen) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... the DPBS resuspended virion pellet was treated with RNase free DNase Set (Qiagen, Cat. No. 79254) which was neutralized with 10mM Ethylenediamine Tetra-acetic Acid (EDTA ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted using the DNeasy Blood and Tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DNA isolation was then performed using DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69506) following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy mini kits (Qiagen, 74104) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... SI03146479 and All Stars negative control SI03650318 siRNAs were from Qiagen. siRNA was transfected with lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: The AllPrep DNA/RNA Micro kit was used to prepare HIO RNA (Qiagen, Germantown, MD). SuperScript IV VILO Master Mix was used to prepare cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was spun down at 14,000g for 30 min and supernatant was applied to Ni-NTA fast kit columns (Qiagen, 30600). Protein was washed with 16 mL buffer B (20 mM Hepes pH 7.3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences of all constructs were verified by Sanger sequencing (Macrogen) and plasmids were purified prior to use (Midi plasmid kit, QIAGEN).
-
bioRxiv - Molecular Biology 2024Quote: ... The top phase was then purified using the MinElute kit (Qiagen), eluting in 50 uL 55°C EB buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA was extracted using the RNeasy kit (Qiagen, Catalog #74104) per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Genomic DNA from FAC-sorted RFP+ cells upon in-utero electroporation was obtained by Qiagen QIAmp DNA Minikit (# 157050681 ...
-
bioRxiv - Microbiology 2024Quote: ... from purified genomic DNA (Qiagen, 12224-50) from vaginal bacteria (Table S4 ...
-
bioRxiv - Genetics 2024Quote: ... and purified by phenol/chloroform extraction using an RNeasy Mini Kit (QIAGEN, Venlo, Netherlands).
-
bioRxiv - Molecular Biology 2024Quote: ... Using miRCURY LNA RT kit (Qiagen), we first generated cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... RNA samples were initially preserved with 1 mL of activated sludge (i.e., suspended phase) in 9 mL of LifeGuard Soil Preservation (Qiagen, Hilden Germany). This solution was thawed and centrifuged (16,000 g for 1-minute ...
-
bioRxiv - Microbiology 2024Quote: ... while samples for RNA-based analyses were mixed at a 1:10 ratio of LifeGuard Soil Preservation (Qiagen, Hilden Germany) before being put on dry ice ...
-
bioRxiv - Molecular Biology 2024Quote: We isolated total RNA from thio-MPMs and BMDMs using miRNeasy kit (Qiagen) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Validated primers were obtained from Qiagen, UK for the miRNAs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA (1 μg) was treated with DNaseI (Qiagen). cDNA was generated using M-MLV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Qiagen Taq polymerase (Qiagen) was used for PCR amplification of target transcripts and products were resolved and imaged on 1-2% agarose gels (Chemi-Doc) ...
-
bioRxiv - Microbiology 2024Quote: ... Then the DNA from viable bacteria was extracted using a blood and tissue extraction kit (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2024Quote: ... ribosomal RNAs were removed with a 5S/16S/23S Fastselect kit (Qiagen). These libraries were prepared with the Kapa Hyper Stranded mRNA library kit (Roche) ...
-
bioRxiv - Microbiology 2024Quote: The rest of the DNA extraction was carried out according to the manufacturer’s instructions for the blood and tissue extraction kit (Qiagen, Hilden, Germany). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from fecal pellet with the QIAamp PowerFecal Pro DNA Kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... an EZ1 extraction was performed using a Qiagen kit with EZ1 DNA Tissue Kit (Qiagen, Courtaboeuf, France) in accordance with the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 180 µL of ATL lysis buffer (Qiagen, Hilden, Germany) and 20 µL of proteinase K (Euromedex ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified from 1.5 mL of cells using the RNeasy kit from Qiagen as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant (300 µL) was mixed with 180 µL of ATL lysis buffer (Qiagen) and 20 µL of proteinase K (Euromedex ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNAs were then purified with the QIAGEN QIAquick PCR Purification Kit (QIAGEN, 28106) and amplified using the PERK or GAPDH promoter primers (Table S5) ...
-
bioRxiv - Microbiology 2024Quote: ... Protease K was purchased from QIAGEN (Hilden, Germany). Propionic acid ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed using a Qiagen kit with the EZ1 DNA Tissue Kit following the manufacturer’s instructions (Qiagen) and DNA was eluted in a 50-μL volume [5].
-
bioRxiv - Microbiology 2024Quote: ... followed by a single extraction with an equal volume of chloroform-isoamyl alcohol (24:1) using Qiagen Maxtract High Density medium (Qiagen, Hilden, Germany). NaCl was added to 300 mM and DNA was precipitated with 2.5 volumes of 100% EtOH at −20°C overnight ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy Mini Kit (QIAGEN) guided by the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... bladders were snap frozen and homogenized for RNA isolation using RNeasy Mini Kit (Qiagen, 74101). Preparation of libraries was done with Ribo-Zero rRNA depletion kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were collected and frozen at −20°C until DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen) according to the Protocol ...
-
bioRxiv - Microbiology 2024Quote: RNA from the CRISPRi and CRISPRa cells was purified by RNeasy Mini kit (Qiagen, #74106) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the genomic DNA (gDNA) was directly extracted from 203 unfixed stool samples using QIAamp® PowerStool Pro DNA Kit (Qiagen, Germany) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... was extracted by using RNeasy Plus Mini Kit (Qiagen), and 1 µg total RNA from each sample was reverse-transcribed using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific™ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gene expression data were analysed by using Rotor-Gene 6000 Software (QIAGEN). The relative expression levels of the target genes were normalised to the endogenous control specific to each sample ...