Labshake search
Citations for Promega :
2001 - 2050 of 2370 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Cells were then transfected with plasmids DNA (250 ng per plasmid per well) using FuGENE HD (Promega, 1:8 ratio), and cultured at 28°C ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Microbiology 2021Quote: ... The constructs were then digested with HindIII and FseI and ligated into the p3T7-TcoV vector using T4 DNA ligase (Promega). The final plasmid was linearised with NotI before purification by ethanol precipitation prior to electroporation into TcoSM cells.
-
bioRxiv - Plant Biology 2021Quote: ... Residual genomic DNA was then removed from each sample with 10 U of RNAse-free DNaseI (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was amplified with Phusion HotStart II DNA polymerase and the PCR fragment was ligated with T4 ligase (Promega) and transformed into Novablue competent cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Visualization of the amplification products was done with ethidium bromide on a 3% electrophoresis gel and sizes were assessed (Bench Top 100bp DNA Ladder; Promega). Negative controls were performed with H2O or by omitting the reverse transcription phase.
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Microbiology 2022Quote: Sinrep-Nluc was constructed by digestion of Sinrep5 plasmid with Xba and StuI and insertion of an NheI-XbaI (blunted by T4 DNA polymerase) fragment containing the Nluc gene of pNL1.1 (Promega, Benelux). The RLuc-SIN-3UTR plasmid was obtained by insertion of a PCR fragment covering the SINV 3’-UTR into a Renilla luciferase reporter plasmid previously described (Girard et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of bacterial culture was pelleted at 15,000 x g for 15 min at 4 °C then samples were prepared according to the directions for the Wizard HMW DNA Extraction kit for Gram-negative Bacteria (Promega). The University of Michigan Microbiome Core quantified the genomic DNA samples ...
-
bioRxiv - Microbiology 2022Quote: ... The resultant plasmid and Bsu36I-digested BmNPV-abb genome DNA [47] were cotransfected into BmN-4 cells using FuGeneHD (Promega). The recombinant virus was purified twice using the plaque assay by identifying OB-producing plaques ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 ng total DNA was added to a 20 μl PCR containing 10 μl GoTaq® Master Mixes (Promega, USA) and 0.1 μM of each primer pair ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 μg plasmid DNA was co-transfected with same amount of low-rate constitutively expressed pRL-TK Renilla luciferase vector (Promega) into mesophyll protoplasts isolated from A ...
-
bioRxiv - Genetics 2020Quote: ... Using the primers provided in Supplementary Table 3 we performed PCRs on 40 ng of genomic material extracted from wild type mosquitoes of the G3 strain using the Wizard Genomic DNA purification kit (Promega). The primers were modified to contain suitable Gibson assembly overhangs (underlined ...
-
bioRxiv - Genetics 2020Quote: ... They were grown to adulthood and their gDNA was individually extracted using either the Wizard Genomic DNA purification kit (Promega) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were validated by DNA fingerprinting through the University of Colorado Molecular Biology Service Center utilizing the STR DNA Profiling PowerPlex-16 HS Kit (DC2101, Promega)(Table S4).
-
bioRxiv - Bioengineering 2019Quote: ... and 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) respectively,52 both in combination with the non-proofreading Taq DNA polymerase (GoTaq, Promega). The primers used for this PCR reaction anneal outside the His6-SpAS1 open reading frame (Table S8) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Cell Biology 2019Quote: Complementary DNAs for PGC1α and LRP130 cloned into the pBIND and pACT vectors were transfected along with pG5luc vector (Promega) and reporter activity measured 48 h later using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The in situ detection of fragmented genomic DNA was performed according to the DeadEnd colorimetric TUNEL (Terminal transferase-mediated dUTP nick-end labeling) system (Promega). Briefly ...
-
bioRxiv - Cell Biology 2019Quote: The Triadin promoter region containing a 882 bp (chr6:123636957+123637838) DNA fragment was cloned into the pGL3 basic vector (Promega) upstream of the luciferase reporter gene ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were grown in 5 mL LB medium overnight and plasmid DNA was isolated using the PureYield Plasmid Miniprep System (Promega). The plasmids were further tested by a restriction enzyme digestion analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... BOSC 23 retroviral packaging cells were ∼70% confluent when transfected with 12 µg of pBABE-mPPARγ2 or pBABE-EGFP plasmid DNA using Fugene 6 transfection reagent (Promega, E2311). Media containing secreted retrovirus was collected 72 hours post-transfection and filtered through 0.45 µm syringe filters ...
-
bioRxiv - Synthetic Biology 2021Quote: ... were generated by in vitro transcription from DNA templates generated by PCR amplification or by fill-in with primer T7X (Supplementary Table 1) using GoTaq (Promega). DNA was purified using QiaQuick (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl of the cDNA reaction mixture was used as a template in a 50 µl PCR amplification reaction mixture with corresponding forward and reverse primers (Table S2) and GoTaq DNA polymerase (Promega), as described by the supplier ...
-
bioRxiv - Microbiology 2020Quote: ... all other ingredients of the reactions were adjusted for use with GoTaq Flexi DNA Polymerase (Promega Corp., Madison, Wisconsin, USA). Reactions were run through an initial denaturing period of 95° C for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... polymerases and Gibson assembly mix reagents were used to manipulate DNA fragments and plasmids according to manufacturer instructions (New England Biolabs and Promega).
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 VLPs were produced by transfecting 2×106 293T-wt cells in T75 flasks with 25 μg total DNA using Fugene6 (Promega). The codon optimised plasmids expressing SARS-CoV-2 M ...
-
bioRxiv - Genetics 2021Quote: ... Cell death was analyzed similarly using a commercially available kit that labels fragmented DNA from apoptotic cells (DeadEnd Fluorometric TUNEL System, Promega).
-
bioRxiv - Genetics 2020Quote: ... The DNA fragments were cloned into upstream of firefly luciferase through Xho1 and Kpn1 in pGL3-basic vector (Promega, E1751). For enhancer activity assay ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene of each isolate was amplified from its genomic DNA using GoTaq G2 Hot Start Master Mix (Promega) and the purified PCR products were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit according to a previous report [15].
-
bioRxiv - Immunology 2019Quote: HEK cells were seeded at 3.0 × 106 cells in 10 cm dishes and transfected with 3 μg of the indicated DNA construct using FuGENE HD (Promega). 24 h post-transfection ...
-
bioRxiv - Genomics 2019Quote: ... The genomic DNA and total RNA were extracted from cells using the Maxwell 16 Cell LEV DNA Purification Kit and the Maxwell 16 Cell LEV Total RNA Purification Kit (Promega), respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... The identity of all cell lines was confirmed by DNA finger printing analysis utilizing the GenePrint® 10 System (Promega). BT-474 and MDA-MB-453 cells were cultivated in DMEM medium (Pan-Biotech ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumor tissue was manually microdissected from the slides and FFPE-DNA and RNA was isolated with the Maxwell system (Promega) according the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... Amplicons were purified using Qiagen PCR Cleanup (Cat no. 28104) and pooled with pTK nanotag reporter vector with T4 DNA ligase (Promega) and BsmBI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... n=4 vaginal) and rUTI (n=3 urine) cohorts belonging to B2 phylogenetic group was extracted (Wizard Genomic DNA Purification Kit, PROMEGA) and sequenced by Illumina NovaSeq 2×150 nt ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted from a small piece of muscle tissue by using a Maxwell RSC Blood DNA Kit with a Maxwell RSC Instrument (Promega). A shotgun DNA library was constructed using a TruSeq Nano DNA High Throughput Library Prep Kit (Illumina) ...
-
bioRxiv - Cell Biology 2020Quote: ... −2784 bp from the start codon to +688 bp from the stop codon) was amplified from Arabidopsis genomic DNA by PCR and integrated into pGEM-T Easy vector (Promega). First ...
-
bioRxiv - Cell Biology 2019Quote: ... Hana 3A cells were authenticated using polymorphic short tandem repeat (STR) at the Duke DNA Analysis Facility using GenePrint 10 (Promega) and shown to share profiles with the reference (ATCC) ...
-
bioRxiv - Biophysics 2021Quote: ... were plated into six-well tissue culture plates containing collagen-coated glass cover slips 12 to 24 h before being transfected with 1 μg of the indicated plasmid DNA using FuGENE 6 transfection reagent (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... Chromosomal DNA was extracted from cultures of cells at both mid-exponential growth phase and (non-replicating) stationary growth phase using the Wizard genomic DNA extraction kit (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... After 1 h incubation at 37°C the sample was cooled down and mixed with 30 Weiss Units of T4 DNA Ligase (Promega) and incubated for 4 h in a water bath at 16°C ...
-
bioRxiv - Genomics 2021Quote: 293T cells were co-transfected with plasmid DNAs of a retroviral vector and the helper vectors using FuGENE HD (Promega). Medium was collected 24 ...
-
bioRxiv - Microbiology 2020Quote: ... were then added to the 3’ ends of all fragments by incubation of 3 µg of size-selected DNA fragments with the recombinant terminal deoxynucleotidyl transferase (rTdT, 30 U/µL, Promega) at 37°C for 1H ...
-
bioRxiv - Microbiology 2020Quote: ... glacialis A3 by filtering cells onto a 3-μm polycarbonate filter and using the Wizard SV Genomic DNA Purification kit (Promega) following the manufacturer’s instructions and quantified on a Qubit 3.0 fluorometer using the DNA high sensitivity assay kit (Thermo-Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded (FFPE) tissue slides using Maxwell® RSC Blood DNA Kit and Maxwell® RSC RNA FFPE Kit (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Immunology 2021Quote: ... cells were transfected with a DNA mixture containing 50 ng of firefly luciferase reporter plasmid (Promega pGL4.31 [luc2P/Gal4UAS/Hygro]), 5 ng of Renilla luciferase plasmid (Promega pRL-CMV) ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4·3Δenv-Luc and Spike-Δ19-D614G by using Profection mammalian transfection kit (Promega Inc) following the instructions in the kit manual ...