Labshake search
Citations for Promega :
2201 - 2250 of 2516 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Integrated sgRNAs in each lymphoma sample were amplified from 100 ng of genomic DNA using GoTaq Green Master Mix (Promega) and indexing primers with unique overhangs (12) ...
-
bioRxiv - Cell Biology 2024Quote: ... the Deaf1 promoter region was first PCR-amplified from genomic DNAs of C2C12 mouse myoblasts and cloned into the pGL4.20 vector (Promega, E675A). ...
-
bioRxiv - Genomics 2024Quote: ... The final DNA yield (17.3 µg) was quantified using a Quantus Fluorometer (QuantiFluor ONE dsDNA Dye assay; Promega, Madison, WI). The size distribution of the HMW DNA was estimated using the Femto Pulse system (Agilent ...
-
bioRxiv - Microbiology 2024Quote: The copy number of re-integrant strains was determined by extracting the genomic DNA and performing quantitative PCR (qPCR) using GoTaq polymerase (Promega) and a StepOnePlus real-time PCR machine (ThermoFisher) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... a 2456 bp DNA fragment of Ccl5 enhancer region and 1500 bp Ccl5 promoter were cloned into a pGL3-basic (purchased from Promega) vector between MluI and HindIII sites.
-
bioRxiv - Cancer Biology 2023Quote: ... 58 °C for 45 seconds and 72 °C for 1 minute (32 cycles) and 72 °C for 10 minutes (1 cycle) using GoTaq G2 DNA polymerase (Promega). Additionally ...
-
bioRxiv - Cell Biology 2023Quote: ... and #294 (5’ CGG AAT TCT TAA TTT GAA GCT GCT GC) from genomic DNA of AX2 digested with EcoRI and ligated into the same site of pGEM-T-Easy (Promega) to yield plasmid #625 ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Phenol-chloroform phase separation and chloroform phase separation steps were repeated to remove the RNase and then DNA was purified from the aqueous phase by using Promega kit protocol (Promega Wizard SV Gel and PCR Clean-Up System ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR—Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Microbiology 2023Quote: Genomic extraction for the WT C6706:str2 strain and each of the resistant mutants was performed using Wizard Genomic DNA Purification Kit (Promega). The concentration of DNA was quantified using Nanodrop spectrophotometer (ND-1000) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.5 µg of the pAC8RedNK vector and 0.5 µg of linearized baculoviral DNA were concurrently transfected into 1×106 Sf9 cells using 6 µl of FuGene HD (Promega) in ESF 921 Insect Cell Culture medium (Expression Systems) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Coding sequences of Nodal and Gdf1/3-like were amplified from cDNA templates of amphioxus embryos and ligated into the pXT7 vector using T4 DNA ligase (Promega). Due to low expression level ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantification of the libraries was done using Quantus Fluorometer and QuantiFluor Double Stranded DNA System (Promega, Madison, Wisconsin, USA, E4870). The libraries were run in the rapid run flow cell and were paired end sequenced (2×76bp ...
-
bioRxiv - Immunology 2023Quote: ... Retrovirus was generated by transfecting the Plat-E packaging cell line with 10 µg plasmid DNA and 30 µl FuGene HD transfection reagent (Promega). Viral supernatants were collected from transfected Plat-E cells at 40 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 µg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Cell Biology 2022Quote: Apoptotic DNA fragmentation was analyzed using the DeadEndTM Fluorometric TUNEL System according to the standard paraffin-embedded tissue section protocol (Promega). The DNAs in nuclei were stained with DAPI at the final preparation step ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were validated by DNA fingerprinting through the University of Colorado Molecular Biology Service Center utilizing the STR DNA Profiling PowerPlex-16 HS Kit (DC2101, Promega)(Extended Data Figure 11).
-
bioRxiv - Cell Biology 2023Quote: ... The amplified DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Cat. N° A9281 Promega), then the DNA was sequenced using the Macrogen facility (https://dna.macrogen.com/).
-
bioRxiv - Genomics 2023Quote: DNA was extracted from the agar/cell mixture from the output and control pools using a Wizard Genomic DNA Purification Kit (Promega). The manufacturer’s protocol was followed with two modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... of neuropeptide and neurotransmitter marker genes were PCR-amplified from zebrafish brain cDNA or genomic DNA and cloned into the pGEM-T Easy vector (Promega). Three glutamate decarboxylase genes (gad1a ...
-
bioRxiv - Cancer Biology 2023Quote: ... First-strand complementary DNA (cDNA) synthesis was performed using 2 μg of total RNA with M-MLV reverse transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Cleaned libraries were then sized-checked with an Agilent Technology 2100 Bioanalyzer using a High sensitivity DNA chip and quantified by Promega Quantus™ fluorometer using OneDNA protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and then reverse transcribed into complementary DNA (cDNA) using 30 enzyme units(U) of the MMLV-RT (Promega, WI, USA) and 1μM of the labeled primer ...
-
bioRxiv - Cell Biology 2022Quote: ... The slides were exposed to 365 nm UV light and the damaged BrdU/BrdC-substituted DNA strands were subsequently digested by 800 U Exonuclease III (Promega) in the dedicated buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcription factors were expressed using at least 2000 ng PCR product per sample with the TnT T7 Quick for PCR DNA in vitro protein expression kit (Promega). All reaction volumes were doubled to yield a total of 100 µL protein product per transcription factor ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the total RNA was incubated with DNase I to remove the trace amount of DNA (Promega Company, Madison. Wisconsin. USA) for two hours ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 20 ng of trichome DNA was amplified by combining 0.25 μM primer and 1X GoTaq Green Master Mix (Promega, USA) in a 50μl reaction volume ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... Cell line authentication was performed by short tandem repeat DNA analysis with the GenePrint 10 System (Promega, Fitchburg, WI, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... and complementary DNA synthesis was carried out using M-MLV reverse transcriptase in the presence of RNasin RNase inhibitor (Promega). PCR primers are all intron spanning ...
-
bioRxiv - Genetics 2023Quote: High molecular weight DNA was isolated from spleen tissue of a single male from each of the 11 imported Nachman wild-derived inbred strains using the Wizard DNA Purification Kit (Promega) or the Monarch HMW DNA kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega) using primers (dPCR_R1_for GGACCACGCTTTCCAGAGAA ...
-
bioRxiv - Genomics 2023Quote: Promoters were amplified from mouse genomic DNA using primers listed in table S1 and cloned into pGL3-Basic (E1751, Promega) using SacI and BglII.
-
bioRxiv - Cell Biology 2023Quote: ... Double transfections were performed using 200 ng total DNA containing 100 ng of Fluc reporter vector and 100 ng of Renilla luciferase (Rluc) vector (pRL-TKl; Promega). After 4 hours of transfection ...
-
bioRxiv - Cell Biology 2023Quote: Promoter fragments containing the CCHCR1-TCF19 intergenic region were cloned from HeLa cell genomic DNA and inserted into the firefly luciferase (Fluc) reporter vector pGL4.17 (Promega, USA), in either forward or reverse orientation ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were plated on three 10 cm tissue culture dishes per condition and transfected 24 h before lysis using FuGENE 6 (6-12 μg total plasmid DNA; Promega). Published protocol can be found on Protocols.io (dx.doi.org/10.17504/protocols.io.kxygx3zeog8j/v1).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Five µg of purified DNA template were used for T7 in vitro transcription using RiboMAX large-scale RNA production system T7 (Promega) in presence of 40 mM cap analog (Ribo m7G Cap ...
-
bioRxiv - Cancer Biology 2024Quote: ... each cell line was single-cell cloned and two of each clone (WT pool, WT Clone 3, HMCES−/− Clones 3.1, 3.3, 3.4) were harvested for genomic DNA (Promega Cat No. A1120). Genomic DNA was submitted for 150 bp paired-end Illumina dep-sequencing sequencing targeting 30X depth at Vanderbilt University’s VANTAGE Next Generation-Sequencing core.
-
bioRxiv - Developmental Biology 2024Quote: ... Lysates were diluted 1:10 with Milli-Q water and processed for PCR using GoTaq G2 Flexi DNA Polymerase kit (Promega). Reactions were placed in a thermocycler on a touchdown program ...
-
bioRxiv - Neuroscience 2024Quote: ... then transfected with pRK5-based constructs of iGluR subunits and Neto variants (1 µg total DNA/ ml cells) using ViaFect transfection reagent (Promega). The cells were incubated at 37°C for 3 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Bacmid DNA was extracted from overnight cultures using isopropanol precipitation as described.72 About 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 μg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Cancer Biology 2024Quote: Human H1-0 promoter sequence (nucleotides −351 to +161 from TSS) was PCR-amplified from REH cell genomic DNA and inserted into Firefly luciferase vector pGL4.22 (Promega, #E6771) at KpnI and HindIII restriction sites ...