Labshake search
Citations for Promega :
2251 - 2300 of 2516 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... subtilis genomic DNA containing RsbT/RsbU was amplified by PCR using GoTaq DNA polymerase mix for thirty cycles without modification from the manufacturers protocol (Promega). DNA sequencing revealed that inserts had on average one to two mutations per product ...
-
bioRxiv - Microbiology 2024Quote: The 3’UTR of human Akt or Pin1 was amplified by PCR from fibroblast genomic DNA and cloned downstream of the Renilla luciferase gene in the psiCHECK-2 dual reporter construct (Promega) by XhoI (Akt ...
-
bioRxiv - Microbiology 2024Quote: SAM-dependant N6mA DNA methylation activity of PglX was probed in vitro using an MTase-Glo Methytransferase Assay kit (Promega). The kit allows indirect measurement of SAM-dependent methyltransferase activity via production of the SAH reaction product ...
-
bioRxiv - Molecular Biology 2024Quote: ... Macroscopic dissection of tumor areas was performed with sterile scalpels and tissues were extracted using the Maxwell RSC FFPE Plus DNA Purification Kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR products were then cloned into the BamHI restriction site of luciferase T7 control DNA plasmid (Cat. No. L4821, Promega). Modifications of uORFs or other mutations were performed using the Q5 site-directed mutagenesis kit (Cat ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were visualized on 1% agarose gels (90 V, 30-45 minutes) against a 1 kb DNA ladder (Promega). Sanger sequencing was performed by the sequencing unit at the Max Planck Institute for Evolutionary Biology ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR amplification of WLV was done using PuReTag Ready-to-Go PCR beads (Illustra) or Go Taq DNA polymerase (Promega) according to the manufacturers’ instructions and WLV-specific primer pairs 4194+4195 ...
-
bioRxiv - Cell Biology 2024Quote: ... The monoclonal cells were screened for successful incorporation in the genomic locus of the fluorescent tag by PCR using GoTaq DNA Polymerase (Promega). The genome-edited cells were confirmed through imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... then transfected with 4 μg pLenti-CMV-PuroDEST-ERK-KTR-mClover DNA plus 12 μL FuGENE 6 (Promega Cat. #E2691) in 800 μL of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Genetics 2024Quote: Regulatory elements were amplified by PCR from human genomic DNA using primers listed in Supplementary Table 10 and cloned into the pGL4.23 Luciferase Reporter Vector (Promega, E8411) linearized with NheI and EcoRV (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... genomic DNA was extracted from a small ear biopsy and PCR was performed with GoTaq® Hot Start Polymerase (Promega) using specific primers (Supplementary Table 1).
-
bioRxiv - Developmental Biology 2024Quote: ... Transfection for each well was performed with a mixture of 2 µg of DNA and 6 µL of Fugene HD reagent (Promega). The DNA/fugene mixture was incubated for 15 minutes at room temperature prior to its drop-wise addition to the infected culture ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was then amplified with the GenomiPhi V2 DNA Amplification Kit (Cytiva Life Sciences) and again quantified using the Quantus Fluorometer and QuantiFluor dsDNA Kit (Promega). Illumina DNA Prep (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... and 1ug of plasmid DNA was used for in vitro protein expression using the TNT rabbit reticulocyte expression system (Promega) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Heterologous expression of proteins was achieved by transfecting cells with 1 □g of plasmid DNA/35 mm using FuGENE HD (Promega; E2311), as previously described (Webb et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the porcine target gene promoter and enhancer were amplified by PCR from total genomic DNA extracted from piPSCs and subcloned into an in-house PGL3-basic vector (Promega, E1751) by Seamless Cloning ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR reaction mixture was prepared for a 10 μL reaction volume using a GoTaq® DNA Polymerase PCR mix (Promega): 2 μL 5X Green GoTaq® Reaction Buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR reaction mixture was prepared for a 10 μL reaction volume using a GoTaq® DNA Polymerase PCR mix (Promega): 2 μL 5X Green GoTaq® Reaction Buffer ...
-
bioRxiv - Genetics 2021Quote: ... and then resuspended in tagmentation reaction mix for 30 min (2.5uL TD1, 1X TD Buffer, Illumina Nextera DNA, FC-121-1030; .25uL 1% digitonin, Promega G9441; 1xPBS;) gently shaking (300rpm on Eppendorf thermomixer ...
-
bioRxiv - Molecular Biology 2020Quote: ... colonies that grow under ampicillin selection were tested by sequencing of the purified plasmid using Wizard Plus SV Minipreps DNA Purification (Promega; A1330). Primer used for the validation sequencing is TTAGGCAGGGATATTCACCA ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Developmental Biology 2020Quote: ... Required fragments were PCR-amplified from wild-type genomic DNA and used as template for preparation of DIG-labeled probe using T7 RNA Polymerase (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 56 Fusobacterium isolates were recovered and subjected to DNA extraction using the Wizard genomic extraction kit (Promega, USA). For each isolate ...
-
bioRxiv - Genomics 2019Quote: ... as described by Rutsaert et al.56 The DNA was subjected to a restriction digest with EcoRI (Promega, Leiden, The Netherlands) for one hour ...
-
bioRxiv - Neuroscience 2019Quote: ... They were plated into 10 cm dishes at 7.5×105 cells per dish and the following day transfected with DNA and Fugene (Promega, Madison, WI) according to the manufacturer’s directions at a ratio of 3:1 with 7 μg each of Syn-Luc1 (S1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA was extracted from freshly isolated zebrafish brains following the instruction of ReliaPrep™ gDNA Tissue Miniprep System (Promega Corporation) and then 3µg of genomic DNA were digested with RsaI and HinfI enzymes (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... Genotyping PCR was performed on 50 ng genomic DNA using oligos from Table S3 from for 40 cycles using GoTaq (Promega #M3001) (94°C 2min ...
-
bioRxiv - Synthetic Biology 2019Quote: Liquid cultures of the transformed cells were used for plasmid extraction and purification using the Wizard® Plus SV Minipreps DNA Purification System kit (Promega). The plasmids quality and concentration were quantified using the Synergy HTX plate reader (BioTek ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA was isolated and region of sgPten targeting was PCR amplified using GoTaq G2 Green Master Mix (Promega, Cat. # M7823). The PCR product was purified using E.N.Z.A ...
-
bioRxiv - Genetics 2019Quote: ... the amplicons were purified from an agarose gel using the Wizard SV Genomic DNA Purification System (Promega Corp., Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... The amplified DNA from each potential off-target site was purified using the Wizard ® SV Gel and PCR Clean-Up System (Promega). The concentration of the purified DNA from the potential off-target sites and the template DNA from the positive control was assessed by using a Nanodrop 2000 Spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The DNA fragment for Island3 probe was amplified from purified genomic DNA using primers GCAGGAATGACAGACAGGCA (Fw) and ACAGAGGTGGGAACATGGAC (Rv) and cloned into pGEM-T easy vector (Promega A1360). Beta-galactosidase staining was performed as in [34] ...
-
bioRxiv - Genomics 2019Quote: ... Genotyping PCR was performed on 50ng genomic DNA using oligos from Table S2 from (Das and Chadwick 2016) for 40 cycles using GoTaq (Promega #M3001) (94°C 2 minutes ...
-
bioRxiv - Genetics 2021Quote: ... of G1 and G2 mosquitoes fluorescently expressing the actin5c::eCFP construct was extracted as individual samples using the Wizard® Genomic DNA Purification Kit (Promega). Regions of gDNA were then amplified according to the three primer pairs as indicated in Fig ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 ul were used as templates for PCR with the srrm3 or srrm4 primers designed to amplify the genomic region of interest (listed in Table S12) and GoTaq® Flexi DNA Polymerase kit (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... liquid cultures were pelleted at 3000 g for 10 minutes and miniprepped using the Tecan Fluent robotic liquid handler with Promega Wizard SV 96 Plasmid DNA Purification Kit (Promega; A2250).
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR reactions were performed using 20 ng of cDNA of WT2 and NBS8 organoids using GoTaq® DNA Polymerase (Promega). Total RNA from commercially human fetal and adult brain (BioChain® ...
-
bioRxiv - Molecular Biology 2021Quote: ... A DNA fragment spanning the promoter and the 5′ UTR of Eef2 was PCR-amplified from mouse NIH3T3 genomic DNA and substituted for the CMV promoter of the psiCHECK2 vector (Promega, C802A). The intergenic region between Renilla and firefly luciferase in this plasmid was replaced by the sequence of HCV IRES PCR-amplified from psiCHECK2-HCV-IRES (Iwasaki et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant sodium channel expressing cell lines were generated by the transfection of wild type and F1579A mutant NaV1.4 BAC DNA constructs into HEK 293 cells (ATCC CRL-1573) by Fugene HD (Promega, Fitchburg, WI) transfection reagent according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was prepared from total RNA as described and contaminating genomic DNA removed by treatment of the RNAs with DNase (RQI Promega WI) before performing the RT qPCR assays (Ittiprasert ...
-
bioRxiv - Microbiology 2019Quote: ... 4 × Promega Wizard® Minicolumns per replicate with a ratio of 0.5:1 virus concentrate to Wizard® PCR Preps DNA Purification Resin (Promega: A7170). The resultant extract was found to be inhibitory to all enzymatic reactions ...
-
bioRxiv - Microbiology 2020Quote: ... DNA quantification was carried out using the QuantiFluor® dsDNA System and the QuantiFluor® ST Fluorometer (Promega, Madison, WI, USA) and its quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... U87 and U251-MG cell lines were authenticated by performing short tandem repeat analysis on isolated genomic DNA with the GenePrint® 10 System (Promega), and peaks were analyzed using GeneMarker HID (Softgenetics) ...
-
bioRxiv - Cell Biology 2020Quote: ... All cell lines were validated by STR DNA fingerprinting using the Promega GenePrint® 10 System according to manufacturer’s instructions (Promega #B9510). HT29 ...
-
bioRxiv - Cancer Biology 2022Quote: ... GB02 and GB03 using the Maxwell® 16 Instrument with the Maxwell® 16 Tissue DNA Purification Kit (Promega, Madison, WI). DNA concentration was determined using the Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The yeast colony was grown overnight in 10 ml of YPD and the gDNA was extracted using the Wizard Genomic DNA Isolation kit (Promega, Switzerland). The PCR reaction was as follows ...
-
bioRxiv - Molecular Biology 2022Quote: DNA extraction was also done for all the samples using the Wizard® Genomic DNA Purification Kit according to the manufacturer’s protocol (Cat#A1120, Promega USA).The eluted DNA was quantified by QuantusTM Fluorometer® (Cat# E6150 Promega Technologies ...
-
bioRxiv - Plant Biology 2022Quote: A 1531 bp segment upstream of the transcription start site was isolated from Arabidopsis genomic DNA with specific oligonucleotides (Supplementary Table S1) and cloned into the pGEM®-T Easy (Promega). After that ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCRs were carried out by loading the same volume of DNA per sample and using GoTaq® qPCR Master Mix (Promega). Details of human-specific primers used are available in supplementary table S3.