Labshake search
Citations for Promega :
1301 - 1350 of 1480 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... A 240 base pair sequence of the human gastrin gene [25] was cloned upstream of the firefly luciferase-encoding sequence in the pGL3B reporter plasmid (Cat #E1751, Promega). Upon reaching 60–75% confluency in 6-well plates ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were grown to 80% confluency prior to transfection with the indicated FLAG tagged ISG15 pcDNA5 plasmids using the FuGene transfection reagent (Promega). After 24 hr ...
-
bioRxiv - Biochemistry 2023Quote: ... by transfection of the pSpCas9(BB)-2A-Puro (PX459) plasmid containing A3B gRNAs with FuGENE 6 Transfection Reagent (E2691; Promega). 16h after transfection ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... In brief: BRD4 bromodomains and full-length HDACs were obtained as plasmids cloned in frame with a terminal NanoLuc fusion (Promega). Plasmids were transfected into HEK293T cells using FuGENE HD (Promega ...
-
bioRxiv - Biophysics 2023Quote: Wild type TDG-HaloTag and TDG-HaloTag variants were expressed from mutant plasmids constructed utilizing Gene Universal Inc with the pHTN HaloTag CMV-neo vector (Promega).
-
bioRxiv - Microbiology 2023Quote: The region upstream of the genes of interest was amplified by PCR with proper primers (Table S4) and cloned into the pGEM-T easy plasmid (Promega). The insert was removed by digestion and subcloned into the pRKlacZ290 vector to generate transcriptional fusions to the lacZ gene ...
-
bioRxiv - Bioengineering 2023Quote: ... A pantropic VSV-G pseudotyped lentivirus was produced via transfection of Lenti-X 293T cells with the pHR transgene expression vector and viral packaging plasmids pCMVdR8.91 and pMD2.G using Fugene HD (Promega #E2312). At 48 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: DNA (genomic DNA pool and plasmid DNA pool) was isolated from the cell library using Wizard SV DNA purification system (Promega) for determining genome engineering efficiencies ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were produced using 5 µg of plasmids in 25 µL in vitro translation reaction of TnT SP6 High-Yield Wheat Germ Protein Expression System (Promega). For the OSH15-RI complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used (Krischuns et al., 2022) and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... and were co-transfected with PB constructs (550 ng) and pBase plasmid (550 ng) using FuGENE HD Transfection (Promega E2311), following the protocol for reverse transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... was cloned upstream a SV40 minimal promoter and a luciferase reporter gene in the backbone of a PGL3 plasmid (Promega). We used lipofectamine 2000 to transfect p53-/- MEFs with 2 μg of either luciferase expression vector ...
-
bioRxiv - Biochemistry 2023Quote: ... pLH3/DTX3L or pLH3/DTX3LΔN) and accessory plasmids pMD2g and psPAX2 (ratio 2:1:1) using ViaFect transfection reagent (Promega E498A). After cell incubation at 37°C for ∼16 h ...
-
bioRxiv - Biochemistry 2023Quote: The assay was performed as described previously.32 In brief: full-length kinases were obtained as plasmids cloned in frame with a terminal NanoLuc-fusion (Promega) as specified in Supplementary Table S3 ...
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... and then transfected with the plasmid encoding GFP-TFEB or mCherry-GFP-LC3 using FuGene HD transfection reagent (Promega, WI), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were plated on three 10 cm tissue culture dishes per condition and transfected 24 h before lysis using FuGENE 6 (6-12 μg total plasmid DNA; Promega). Published protocol can be found on Protocols.io (dx.doi.org/10.17504/protocols.io.kxygx3zeog8j/v1).
-
bioRxiv - Neuroscience 2023Quote: ... HEK293 cells were then plated onto 35 mm glass coverslips pre-coated with poly-D-lysine (100 g/mL) and transfected with 300 ng of each plasmid using FuGene transfection reagent (Promega) or Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Biochemistry 2023Quote: The assay was performed as previously described.61 In brief: full-length kinases were obtained as plasmids cloned in frame with a terminal NanoLuc-fusion (Promega) as specified in Table S4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase assays were performed by co-transfecting HEK-293T cells with 100 ng pCMV6-empty or pCMV6-miR-497/195 with 10 ng of psiCHECK2 reporter plasmids using FuGENE6 (E2691; Promega) and performing the Dual-Luciferase Reporter Assay System (E1910 ...
-
bioRxiv - Biochemistry 2024Quote: ... HEK293T cells were transfected with 3.5μg of N-terminally FLAG-tagged receptor and 3.5μg of an SRE-based luciferase reporter plasmid pGL4.33 (Promega, Cat. no: E1340). 14-16h after transfection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The extracted plasmid was linearized by SalI digestion and purified using the Wizard SV PCR cleanup system (Promega, Madison, WI). SMRT sequencing was performed using Sequel IIe (Pacific Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... HA-dTAG-RBM7 cells were transfected with pB[MYC-RBM7x] BSD plasmids along with a pB transposase expressing vector (pBASE) using Viafect transfection reagent (Promega). Cell pools were selected using BSD for 7-10 days or until negative control cells no longer survived ...
-
bioRxiv - Genetics 2023Quote: ... carrying the non-risk or risk allele of each SNP (Supplemental Table 4) were cloned into the no-promoter firefly luciferase reporter plasmid pGL4.14 [luc2/Hygro] (Promega, #E6691) or minimal promoter firefly luciferase reporter plasmid pGL4.26 [luc2/miniP/Hygro] (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Microbiology 2024Quote: ... the reporter virus plasmid was linearized and in vitro transcribed to generate RNA using T7 RiboMax Express Large Scale RNA Production System (Promega). Transcribed RNA was purified using RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: Each ZNF410 peak and all the variants of ZNF410 motif mutant sequences were sub-cloned into pGL4.24 plasmid (Promega, #E8421). About 1.2 μg WT or constructed pGL4.24 plasmid and 0.2 μg pGL4.74 control plasmid (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... The FXR DBD (residues 120-196) and the hinge region (residues 197-243) were cloned into the pACT plasmid (Promega) to generate fusion proteins with the VP16 activation domain ...
-
bioRxiv - Biochemistry 2024Quote: The assay was performed as described previously.38 In brief: full-length kinases were obtained as plasmids cloned in frame with a terminal NanoLuc-fusion (Promega) as specified in Supplementary Table S5 ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction of samples was performed according to an adapted version of the “DNA purification from human feces using the Maxwell® RSC instrument and the Maxwell® RSC PureFood GMO and Authentication Kit” developed by Promega (Promega Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... RPGR wild-type minigene construct was generated (Figure 2A) by amplification from a pool of human female genomic DNAs (Promega, Milan, Italy) using the following primers:
-
bioRxiv - Biophysics 2022Quote: pHalo-PPARγ2 expresses human PPARγ isoform 2 fused to HaloTag in the N-terminus under a CMVd1 promoter (Promega ORF clone #FHC08305). PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: The extent of ADCC activation induced by human γ-globulins was evaluated with the use of an ADCC Reporter Bioassay (Core Kit; Promega, G7010) and the EnSpireMultimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Cell Biology 2023Quote: ... the corresponding promoter regions of the human KLF2 and KLF4 genes were amplified using human genomic DNA as a template and cloned into the BglII site of the GL4 basic vector (Promega, Fitchburg, WI). Point mutants of the vectors were constructed by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Immunology 2024Quote: ... qPCR targeting the β-globin gene was performed for each sample and evaluated alongside a β-globin calibration curve (human gDNA, cat# G1521, Promega).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Transfection of HEK293T cells was performed at 80% confluence using 25ng of each plasmid construction mixed with 150nL of Fugene 6 (E2691, Promega, France) reagent per well ...
-
bioRxiv - Cell Biology 2020Quote: ... Heterologous expression of proteins was achieved by transfecting cells with 1 □g of plasmid DNA/35 mm using FuGENE HD (Promega; E2311), as previously described (Webb et al. ...
-
bioRxiv - Cell Biology 2020Quote: BBSome subunits and fragments thereof were translated in vitro from pCS2-Myc plasmids using the TNT SP6 Quick Coupled Transcription/Translation system (Promega L2080). 16 µL TNT SP6 Quick Master Mix ...
-
bioRxiv - Molecular Biology 2020Quote: ... colonies that grow under ampicillin selection were tested by sequencing of the purified plasmid using Wizard Plus SV Minipreps DNA Purification (Promega; A1330). Primer used for the validation sequencing is TTAGGCAGGGATATTCACCA ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting 2.6-kb fragment was separated from the 1.4-kb fragment and uncut plasmid by agarose gel purification (Promega Gel Wizzard Kit). A set of oligonucleotides that form a biotinylated and primed fork was ligated to one end of the fragment and the final product purified on a Sepharose-4B column as previously described [42] ...
-
bioRxiv - Synthetic Biology 2019Quote: Liquid cultures of the transformed cells were used for plasmid extraction and purification using the Wizard® Plus SV Minipreps DNA Purification System kit (Promega). The plasmids quality and concentration were quantified using the Synergy HTX plate reader (BioTek ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were transfected with 700 ng of plasmid construct (PIB/V5_Gr9) and 3 μl of FuGENE® HD transfection reagent (Promega, USA) in 100 μl of medium per well ...
-
bioRxiv - Genomics 2019Quote: ... we used a standard curve approach with serial ten-fold dilutions of plasmids engineered to contain single copy PCR templates (pGEM®-T Easy Vector, Promega).
-
bioRxiv - Biochemistry 2021Quote: ... liquid cultures were pelleted at 3000 g for 10 minutes and miniprepped using the Tecan Fluent robotic liquid handler with Promega Wizard SV 96 Plasmid DNA Purification Kit (Promega; A2250).
-
bioRxiv - Microbiology 2021Quote: ... the lacZα expression cassette encoding the alpha-fragment of the β-galactosidase under control of the lac promotor and operator was amplified from the circularized plasmid pGEM-T (Promega) using the forward primer 596 that includes a 5’ XhoI restriction site and the reverse primer 597 which includes a 3’ KpnI restriction site ...
-
bioRxiv - Cancer Biology 2020Quote: ... expression of the luciferase reporter plasmid followed by measurement of luciferase activity after lysing cells with Bright-Glo Luciferase Assay System (Promega #E2610), both using Biotek Cytation 5 plate reader ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...