Labshake search
Citations for Promega :
1051 - 1100 of 1480 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... and SacI/XhoI restriction site overhands were annealed then ligated into the dual luciferase reporter plasmid (Promega, Cat#E1960). For mutated sequences ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were cultured on 12-well plates and transfected with the indicated plasmids using Viafect (Promega, Madison, WI). After expression for 24h ...
-
bioRxiv - Molecular Biology 2020Quote: pCDH-WSB1 and pGL4.14-c-Myc promoter-luciferase plasmids as well as pCDH-WSB1 and pGL4.14-TCF/LEF1-luciferase plasmids were transfected on H460 and tested with the Luciferase reporter kit (Promega) in the same way ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutations were verified by sequencing (Macrogen) and DNA for transfection was purified using the PureYield Plasmid MaxiPrep System (Promega).
-
bioRxiv - Molecular Biology 2019Quote: ... were plated in T25 flasks and transiently transfected with 2.5 µg plasmid DNA per flask using FuGENE HD transfection reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg of sgRNA construct and 1.5 μg of linearized HDR plasmid were transfected into RPE1 cells using Fugene 6 (Promega). Positive cells were FACS sorted to isolate the Ndc80-EGFP expressing cells and single clones were identified by visual inspection with fluorescent microscope ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293T cells in 12-well plates were co-transfected with 0.05 µg each of GLP-1R-SmBiT and βarr2-LgBiT plasmid (Promega) plus 0.9 µg pcDNA3.1 ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR reactions with 50 ng plasmid template were performed in 50 µl volume containing 10x DreamTaq buffer and 2.5 units of DreamTaq polymerase (Promega). Standard PCR conditions were 94 °C for 5 min ...
-
bioRxiv - Bioengineering 2019Quote: ... Linearized plasmid DNA was purified using the Wizard® SV Gel and PCR Clean-up Kit (Promega, Madison, WI) in preparation for transfection into Jurkat cells.
-
Low basal expression and slow induction of IFITM3 puts immune cells at risk of influenza A infectionbioRxiv - Immunology 2019Quote: HEK293 IFITM3−/− cells were plated in a 6-well dish for 24 hours prior to transfection of IFITM3-pcDNA3.1 plasmid DNA using FuGene 6 reagent (Promega) at a ratio of 3:1 ...
-
bioRxiv - Genomics 2019Quote: ... 120 ng of plasmid per well were transfected along with 30 ng of pGL4.74 Renilla luciferase expression vector (Promega), to correct for transfection efficiency ...
-
bioRxiv - Cell Biology 2019Quote: ... parental HeLa cells were transfected with 2 μg plasmid containing a GFP cassette and 4 μl FuGENE HD (Promega) in a six-well cluster ...
-
bioRxiv - Microbiology 2020Quote: ... Transfection was performed using 100 ng of expression plasmid using 0.3 μl of FuGENE HD Transfection Reagent (Promega E2311) in 20 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: The assay was performed as described previously.22,23 In brief: full-length kinases were obtained as plasmids cloned in frame with a terminal NanoLuc-fusion (Promega) as specified in Supplementary Table 6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... reversely transfected into LNCaP or VCaP (treated with DHT or ETH) cells with a Renilla Luciferase control plasmid pGL4.75 [hRluc/CMV] (Promega) by using X-treme GENE HP DNA Transfection Reagent (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... with two plasmids – one containing the pRL Renilla luciferase gene under the control of the CMV promoter (# E2261, Promega) and the other containing the firefly luciferase gene under the control of the Pomc promoter (−646bp to +65bp ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with linearized repair templates and the PX459 plasmid containing the appropriate guides using FuGENE HD (Promega) with a ratio of Reagent ...