Labshake search
Citations for Promega :
7701 - 7750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: DNA was extracted from the agar/cell mixture from the output and control pools using a Wizard Genomic DNA Purification Kit (Promega). The manufacturer’s protocol was followed with two modifications ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Genomics 2023Quote: ... genomic DNA was extracted from pure culture colonies using the Wizard genomic DNA extraction kit (Promega, USA) and sent to the Wellcome Sanger Institute for whole genome sequencing using the Illumina Hiseq 2500 platform ...
-
bioRxiv - Immunology 2023Quote: ... Urea concentration was further adjusted to 2M using 50mM Tris pH 8 and Lysyl peptides were additionally digested with sequencing grade trypsin (Promega, Madison, WI) in an enzyme/substrate ratio of 1:20 at 37°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... then transfected with 4 μg pLZRS-GCaMP6 DNA plus 12 μl FuGENE 6 (Promega Cat. #E2691) in 800 μl of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were then digested overnight at 37°C with Trypsin Gold (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the indicated plasmids using FuGENE 6 (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Genetics 2023Quote: ... the samples could be reamplified and reanalyzed by either Powerplex® Fusion 6C system (Promega) or VerifilerTM amplification kit (Applied Biosystem ...
-
bioRxiv - Immunology 2023Quote: ... The samples were diluted by 100 mM NH4HCO3 and digested with trypsin (Promega) at ratio of 1:20 (w/w ...
-
bioRxiv - Immunology 2023Quote: Activation of chemokine receptors was detected by measuring ß-galactosidase activity using the commercially available Beta-Glo assay system (Promega Corp, Madison, WI, USA) and luminescence signal was recorded on a multimodal plate reader (Enspire 2300 ...
-
bioRxiv - Genetics 2023Quote: ... 3μL of 5X Colorless GoTaq Flexi buffer (Promega, USA), 1.2 mM MgCl2 ...
-
bioRxiv - Genetics 2023Quote: ... and 1 unit of GoTaq G2 Flexi DNA Polymerase (Promega, USA). Thermocycling conditions for S ...
-
bioRxiv - Genetics 2023Quote: ... Transcriptional activity was investigated by Dual-Luciferase Reporter Assay System (Promega) after 48 hours of transcription ...
-
bioRxiv - Genetics 2023Quote: ... Promoter region of IGF2BP1 was cloned into the PGL3-Basic luciferase vector (Promega) that was subjected to transfection into DF-1 cell line (chicken fibroblast cell ...
-
bioRxiv - Genetics 2023Quote: ... treated the samples with DNase (Promega), and synthesized cDNA as previously described (Chen et al. ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Genetics 2023Quote: ... One microgram of Trypsin Gold (Promega) was added to each sample and incubated in an end-over-end mixer at 37°C for 16 hours ...
-
bioRxiv - Genetics 2023Quote: ... 0.125 µL of 5X GoTaq® G2 Flexi DNA Polymerase (Promega) in sterile water ...
-
bioRxiv - Genetics 2023Quote: ... and 1 mM DTT (Promega REF V3151). Resuspended tissue was transferred to a 5 ml Eppendorf tube (Fisher Catalog No ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega). 250 ng of genomic was used in each PCR1 amplification with Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Genetics 2023Quote: ... and genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect at a 3:1 ratio (using 1.5 µL FuGENE 6 and 0.5 µg DNA per well) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-1-gal (1:1000, Promega Z378B), mouse anti-1-gal (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... The first-strand cDNA was converted using a reverse transcription system (Promega, Wisconsin, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... lactate dehydrogenase (LDH) release assay was performed using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, Madison, Wisconsin, USA) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... a mix was prepared consisting of 5 % PEG-8000 (Promega), 100 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted using the Wizard Genomic DNA purification kit (Promega, USA) and stored at −20 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... then performed tissue lysis and DNA isolation using the Wizard SV Genomic DNA Purification kit (Promega). We fluorometrically quantified DNA using the PicoGreen dsDNA kit (Life Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the cells were lysed using a passive lysis buffer (Promega) and equal amounts of lysates were used for luciferase reporter assay following the manufacturer’s instructions (Promega).
-
bioRxiv - Evolutionary Biology 2023Quote: ... or a Maxwell® 16 LED DNA kit (Promega, Madison, WI, USA) according to standard procedure ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and equal amounts of lysates were used for luciferase reporter assay following the manufacturer’s instructions (Promega).
-
bioRxiv - Evolutionary Biology 2023Quote: ... was combined with 9.6 μL FUGENE 6 (Promega #E2691) and incubated for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... before in-gel digestion using modified trypsin (Promega, sequencing grade) as previously described (Casabona et al. ...
-
bioRxiv - Genomics 2023Quote: ... The resulting DNA was resuspended in 1× IDTE buffer (Integrated DNA Technologies, Coralville, IA, USA) and quantified using the QuantiFluor One dsDNA kit (Promega, Madison, WI, USA). The HiFi reads were obtained using the SMRT Cell 8M and the PacBio Sequel II instrument ...
-
bioRxiv - Genomics 2023Quote: ... and 0.5 U ml−1 RQ1 DNase I (Promega, M6101). The samples were incubated at 37 °C in successive 10-minute rounds with gentle vortexing every 2 minutes and trituration every 5 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... Each product was cloned into the pANT vector (Nippon Gene) or pGEM-T easy (Promega) and sequenced with M13F-pUC or M13R-pUC primers (Table S3).
-
bioRxiv - Developmental Biology 2023Quote: ... pGL4.74 containing the Renilla luciferase gene was used for normalization of reporter expression (Promega, E6921). Coding sequences of mouse Hoxd13 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Luciferase activity in the cell lysates was measured using a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: The highly conserved 998-bp core sequence of Xenopus tropicalis MFCS1 was amplified by PCR with specific primers (Table S3) and inserted into the Acc65I and XhoI sites of the pGL4.23 vector (Promega, E8411). Then the minimal promoter of the pGL4.23 vector was replaced with a 486-bp sequence of Xenopus laevis shh promoter (Fig ...
-
bioRxiv - Developmental Biology 2023Quote: ... hes7.1 and hes2 constructs were cloned from total reverse-transcribed cDNA into pCS107 for overexpression and/or pGEM-T Easy (Promega #A137A) for anti-sense probes using primers listed below ...
-
bioRxiv - Developmental Biology 2023Quote: ... the QuantiFluor™dsDNA System from Promega was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... and synthesized with T7 (Promega #P207E) mRNA encoding membrane-GFP was used in some experiments as lineage tracers at 50ng/µL ...
-
bioRxiv - Developmental Biology 2023Quote: ... All mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B).
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification of DNA was performed using GoTaq (Promega, Cat# M7123) or Phusion (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... were DNAse treated (Promega), and were further cleaned with an RNA clean and concentrator kit (Zymo Research) ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNAs were purified using the PureYield Midiprep kit and were linearized before in vitro synthesis of anti-sense RNA probes using T7 or Sp6 polymerase (Promega, #P2077 and #P108G), RNAse inhibitor and dig-labeled rNTPs (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... and transferred to 96-well black plate to be treated with LARII and Stop & Glo components according to protocol of the Dual-Luciferase® Reporter Assay Kit (Promega CN: E1910). Luminescence was measured using a microplate reader (TECAN infinite M200pro) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Ghost Database KY21.Chr1.1715) we extracted genomic DNA from local Norwegian animals using the Wizard Genomic DNA Purification Kit (A1120, Promega). We then used the purified gDNA at a concentration of 100-150ng/μl ...