Labshake search
Citations for Promega :
7651 - 7700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... using trypsin (150 ng sequencing grade modified trypsin V5111; Promega) after reduction with 10 mmol/L dithiothreitol and alkylation with 55 mmol/L iodoacetamide proteins (29).
-
bioRxiv - Genomics 2023Quote: ... 0.01% Digitonin (Promega), 2.5 μl Tagment DNA TDE1 enzyme (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were assayed for dual-luciferase activities using Dual-Glo Luciferase Assay System (Promega) and a Biostack4 (BioTek ...
-
bioRxiv - Plant Biology 2023Quote: ... Luciferase assay was performed by luciferase assay kit (Promega; E152A) as manufacturer’s instruction ...
-
bioRxiv - Systems Biology 2023Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1–2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Plant Biology 2023Quote: ... Lys-C digest was further digested with 0.1 μg trypsin (Promega) with shaking at 1,000 rpm at 37°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... gel pieces were dried and subsequently rehydrated in solution containing 12 ng/μL Trypsin Gold (mass spectrometry grade from Promega), 0.01% ProteaseMAX surfactant (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNasein Plus (Promega), and cOmplete protease inhibitor) ...
-
bioRxiv - Microbiology 2023Quote: Cell supernatants were collected and stored in LDH storage buffer + Triton 10% as per the manufacturer’s instructions (Promega). Supernatants were inactivated for 2 hours at room temperature prior to usage outside the BSL-3 ...
-
bioRxiv - Microbiology 2023Quote: ... 50 μL of diluted supernatant was then added to 50 μL LDH substrate mix as described by Promega. LDH activity was recorded using the VICTOR3 multilabel plate reader (Perkin-Elmer).
-
bioRxiv - Synthetic Biology 2023Quote: ... The proteins were digested with 1 μg of lysyl endopeptidase (LysC) (FUJIFILM Wako Pure Chemical Corporation) and 1 μg of trypsin (Promega, Tokyo, Japan) overnight at 37 °C in a shaking incubator ...
-
bioRxiv - Synthetic Biology 2023Quote: Gene constructs were cloned into the pTNT™ vector (Promega). BL21(DE3 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and polyethylene glycol solution concentrate was added (5X concentrate: PEG 8000 MW Promega, V3011 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The luminescence signal from both assays was measured using the Glomax 20/20 luminometer from Promega (Madison, WI).
-
bioRxiv - Neuroscience 2023Quote: ... Beta III Tubulin (1:2000, Promega), and PSD-95 (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1LJμg of sequencing-grade trypsin (Promega) and 125LJμL of digestion buffer (50LJmM TEAB ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were injected with 25 μl of GloSensor substrate (Promega) and incubated for 2 h in the dark at room temperature and in an odor-free environment ...
-
bioRxiv - Microbiology 2023Quote: ... using GoTaq® Probe qPCR Master Mix (Promega, Madison, WI, USA) and the CDC 2019-Novel Coronavirus (2019-nCoV ...
-
bioRxiv - Immunology 2023Quote: ... The dual reporter luciferase assay (#E1910, Promega) was conducted following the manufacturer’s instructions and luminescence was detected on a BioTek Synergy HT plate reader (integration time ...
-
bioRxiv - Cell Biology 2023Quote: ... The obtained cDNA was used as the template for quantitative real-time PCR (qRT-PCR) using qPCR Mastermix (Promega). mRNAs expression levels were normalized to actin-5C mRNA used as the internal control ...
-
bioRxiv - Neuroscience 2023Quote: ... 2018) resulting in two fractions after sequential proteolysis with first Lys-C (Wako Chemicals) followed by trypsin (Promega). Peptides were analyzed on a Q Exactive HF mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: The pOXA-48TET plasmid was extracted using the Wizard genomic DNA purification kit (Promega). The pUN4 and pBAD18 derivatives were isolated using the Plasmid Easypure isolation kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2023Quote: ... or 9 Reagent (Promega) with MG-132 Inhibitor (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter-Glo 2.0 (Promega) was used according to manufacturers instructions to quantify cell viability.
-
bioRxiv - Biophysics 2023Quote: Spodoptera frugiperda Sf9 cells were then transfected with these bacmids using FuGene Transfection Reactant (Promega). Baculoviruses were amplified in Sf9 cells at 28 °C.
-
bioRxiv - Biochemistry 2023Quote: NanoLuc substrate stock solution was purchased from Promega (Madison, WI, USA) and stored at −80 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter-Glo (Promega G7570). Plates were cooled to room temperature for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: Luciferase DNA was constructed by cloning luciferase gene (luc2) (pGL4.13, Promega, Madison, WI), 120 adenine ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TaqMan universal PCR master mix (Promega) and the CFX96 Touch Real-Time PCR Detection System (BioRad Laboratories ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat Gβ1 was fused with a His-tag at the N terminus and with a SmBiT subunit (peptide 86, Promega)34 after a 15-amino acid linker at its C terminus ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequencing grade trypsin (Promega, WI) was diluted in HA buffer so that adding 2 μL of trypsin to each heat denatured aliquot resulted in a 1:100 molar ratio of trypsin to spike ...
-
bioRxiv - Biochemistry 2023Quote: ... in 25 mM NH4HCO3 (pH 8.0-8.5) and 0.01% ProteaseMAX w/v (Promega) for 16 hr at 37⁰C ...
-
bioRxiv - Cancer Biology 2023Quote: Cell viability assays were performed using the RealTime-Glo™ MT Cell Viability Assay according to the manufacturer’s protocol (Promega, Madison, WI, USA). Cells were seeded in standard media in white-walled 96-well plates at a density of 5000 cells/well and were allowed to attach overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were then incubated with Dual-Glo luciferase substrate (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cells using Maxwell 16 LEV Simply RNA Tissue Kit (Promega, Madison, WI, USA), according manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Triglyceride-GlowTM assay kit (Promega, Madison, WI), respectively ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from MB cells treated with RA for 48 h was extracted using the SV Total RNA Isolation System kit (Promega, Madison, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RealTime-Glo Annexin V Apoptosis and Necrosis Assay (Promega), respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter-Glo 2.0 Cell Viability Assay (Promega) and RealTime-Glo Annexin V Apoptosis and Necrosis Assay (Promega) ...
-
bioRxiv - Cancer Biology 2023Quote: MSI status was determined using the MSI Analysis kit (MD1641, Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was assessed using CellTiter-Glo as per the manufacturer’s instruction (Promega, Madison, WI, USA) on a SpectraMax i3 plate reader either at 48 hours post treatment (Gem ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was removed and CellTiter-Blue (Promega G8081) was added to the plates ...
-
bioRxiv - Cell Biology 2023Quote: The halo pulse chase assay was carried out as per manufacturer’s instructions (Promega, Inc). Parasites were grown overnight in confluent HFF monolayers in MetTak dishes ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 5’UTR region of the cyclin E gene was amplified from normal human peripheral blood lymphocytes genomic DNA using the Phusion High Fidelity DNA polymerase and was cloned downstream of the SV40 promoter and upstream of the firefly luciferase cDNA sequence in the pGL3 control vector (Promega, Madison, WI, USA). The DDX3X knockout HEK293FT cells were co-transfected with the Cyclin E-5’UTR luciferase reporter construct ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.2U/µl RNAsin (Promega, cat.no. N2615)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was measured using CellTiter-Glo (Promega) and compared with one-way Anova and Tukey’s test.
-
bioRxiv - Cell Biology 2023Quote: ... cells were assayed for luciferase activity using the dual luciferase assay kit (E1910, Promega, Madison, WI) as per manufacturer’s protocol ...