Labshake search
Citations for Promega :
6351 - 6400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... eGFP coding sequence was replaced by HaloTag (pFN23K-Halo plasmid, given by St Jonhston lab, Promega G2861), amplified using primers CACCTAGGATGGCAGAAATCGGTACTGGCTTTCCATTCGACC and CTACGCGTTGCCGGAAATCTCGAGCGTGG for Su(H)::Halo ...
-
bioRxiv - Cell Biology 2023Quote: ... samples were proteolyzed with 0.5µg of Trypsin (Promega, sequencing grade) for 16h at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 in storage buffer and analyzed as indicated in the manufacturer’s protocol (LDH-Glo Cytotoxicity Assay, Promega, #J2381).
-
bioRxiv - Cell Biology 2023Quote: ... incubated 3 h at 37°C and alkaline phosphatase (SEAP) activity determined measuring the absorbance at 600 nm using GloMax®-Multi Detection System (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 units of calf intestinal alkaline phosphatase (Promega; M182A) at 37°C for 10 min at 1000 rpm in a Thermomixer ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8.5 to a final urea concentration of 2 M for Trypsin/Lys-C based overnight protein digestion at 37 °C (40 µg of protein used for global proteomics and the remainder for phosphoproteomics, 1:70 protease: substrate ratio, Mass Spectrometry grade, Promega Corporation, Cat No: V5072.) Digestions were acidified with trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2023Quote: ... ∼20 bp taken from the backbone of plasmid pSP72 (Promega, P2191) was added onto the outside end of both 5’ and 3’HDRs ...
-
bioRxiv - Cell Biology 2023Quote: ... and digested on-bead using filter-aided sample preparation (Wiśniewski, Zougman, Nagaraj, & Mann, 2009) with sequencing grade modified porcine trypsin (Promega). Tryptic peptides were separated by reverse phase XSelect CSH C18 2.5 µm resin (Waters ...
-
bioRxiv - Cell Biology 2023Quote: Activity of Hsf1 was determined by adding 50 µl of cell suspension (cells expressing the pSSA3HSE-lacZ plasmid) to 50 µl of β-Glo reagent (Promega) in a white 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... or Viafect (Promega; E4981) for transient overexpression according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Either GFP-VCP-A232E or GFP-FUS-R495X were transfected into cells using ViaFect transfection reagent (Promega) 24 h prior to the start of the experiment ...
-
bioRxiv - Cell Biology 2023Quote: ... the injectors were washed following the manufacturer’s protocol and primed with the luciferase assay substrate (Promega, USA) diluted in water (1:10) ...
-
bioRxiv - Cell Biology 2023Quote: ... the antigen was detected with the enhanced chemiluminescence (ECL) detection system (Promega) as specified by the manufacturer with Azure Sapphire Biomolecular Imager (Azure Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... lysed in 100 µl 1X reporter lysis buffer (Promega, USA), vortexed and centrifuged (13000 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... pRL SV40 Renilla luciferase reporter vector is available commercially from Promega. HEK293 cells were seeded at 0.5x105 cells/well in 96-well clear bottom white plates (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... Freshly thawed Janelia Fluor® 549 HaloTag® Ligand (Promega, GA1110) was diluted to 200nM in warmed CM and cells incubated for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: Cells grown under confluency were incubated in CM+bFGF media containing 1μM cell permeable Janelia Fluor® 549 HaloTag ligand complex (Promega, GA1110) for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated proteins were digested with 1:50 w/w LysC (Wako Chemicals, cleaves at the carboxylic side of lysine residue) and 1:100 w/w trypsin (Promega, Sequencing-grade ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were then digested into peptides with sequencing grade modified trypsin (Promega V5113) at 37 °C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... and subsequently stained with Diamond™ Nucleic Acid Dye (Promega, H1181) for 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... coli (Promega, JM109), and plated on LB-Ampicillin plates ...
-
bioRxiv - Biophysics 2023Quote: ... 0.8% agarose (Promega, V3125), 0.5 µg/ml etidium-bromide (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: For luciferase expression 20 uL of undiluted sample was loaded onto a black 96 well-plate then 100uL luciferin solution (Promega) added immediately before reading on a luminometer (Wallac) ...
-
bioRxiv - Bioengineering 2023Quote: ... and its concentration was determined using a Quantus Fluorometer and QuantiFluor RNA system (Promega). The RNA quality was evaluated using a 5200 Fragment Analyzer System and an Agilent HS RNA Kit (Agilent Technologies ...
-
bioRxiv - Biophysics 2023Quote: ... the handles were purified using a PCR clean up kit (A9282, Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... Reporter activity was analyzed 48 hr post-transfection with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). Luminescence was analysed with a Varioskan plate reader using SkanIT software.
-
bioRxiv - Biophysics 2023Quote: Analysis of GTP turnover was performed by using a modified protocol of the GTPase-GloTM assay (Promega) described previously21 ...
-
bioRxiv - Biophysics 2023Quote: ... The Dual Luciferase assay (Promega) was performed according to instruction manual and measured luminescence signals on SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Biophysics 2023Quote: HeLa cells expressing each Halo-tagged chromatin remodeler were labeled with 5 nM Janelia Fluor® 549 (JF549) Halo-tag® ligand (GA1110, Promega) for 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Furimazine (NanoGlo; 1:1000, Promega) was added to all wells immediately prior to making measurements with Nanoluc ...
-
bioRxiv - Biophysics 2023Quote: ... followed by incubation with anti-HaloTag mAb (Promega) at a 1:2000 dilution in blocking buffer ...
-
bioRxiv - Biophysics 2023Quote: ... α-catenins and CPC were thawed and incubated with JF-646-Halo (Promega) for 2 hours on ice in a 1:1 molar ratio ...
-
bioRxiv - Biophysics 2023Quote: ... sapiens αE-catenin56-906 (FL α-catenin) or αE-catenin56-871 (α-catenin ΔC) and HaloTag (Promega) into pET vector 2HR-T through Gibson assembly (57).
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-mouse (Promega, W4021, dilution 1:3000) and rabbit anti-goat (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated for 20 min in 100 nM cell-permeable halotag conjugated to Janelia Fluor 549 dye (Promega) before washing twice with PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples containing 5-10 µg of protein were mixed with 0.25-0.5 µg BSA (used as an internal standard in this analysis) and cleaved with 1 µg trypsin/LysC mix (Promega, Madison, WI) using the SP3 beads protocol described in (Hughes et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... CellTiter Non-Radioactive Cell Proliferation MTT Assay Kit (Promega; USA) was used according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... add 600 μl of Nuclei Lysis Solution (Promega) and mix by pipetting ...
-
bioRxiv - Cell Biology 2023Quote: ... CHMP4B signal was visualized using far-red HALO ligand according to manufacturer recommendations (Promega catalog GA1120). Cells were processed as above for imaging ...
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis by TUNEL assay (G3250, Promega, Madison, WI, USA) following the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... FuGENE (FuGENE, Promega, Cat# E2920) were used as transfection reagent at 3:1 (FuGENE/plasmid mass ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a Dual-Glo luciferase kit (Promega, Cat# E2920) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pDEST26-Renilla plasmid (0.1 μg) using FuGENE® HD (Promega, Cat# E2312). Twenty-four hours after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Firefly and Renilla luciferase activity were assayed by Dual-Glo Luciferase assay system (Promega). Relative activity was calculated by fixing the AR and eGFP transfected cells at 100% ...
-
bioRxiv - Cancer Biology 2023Quote: ... The number of viable cells was measured using CellTiter-Glo® 3D Luminescent Cell Viability Assay (#G9683, Promega, Madison, USA) according to the manufacturers protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... The firefly luciferase activity was measured using luciferase assay reagent (Promega) according to manufacturer’s protocol on a Synergy Mx microplate reader (BioTek).
-
bioRxiv - Biochemistry 2023Quote: In vitro translation of DHX15-G4-FL and DHX15-G4-Del-FL transcripts in the presence of F1 or BRACO19 was carried out in a cell-free translation system of rabbit reticulocyte lysates (Promega) following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequencing grade modified trypsin was purchased from Promega (Madison, Wisconsin, USA). MagReSyn® HILIC microspheres were purchased from ReSyn Biosciences (Edenvale ...
-
bioRxiv - Biophysics 2023Quote: ... Subsequently we ran the digested fragment on a 1% TAE agarose gel and the desired ∼14 kbp DNA fragment was isolated from an agarose gel using a gel purification kit (Promega, A9282).