Labshake search
Citations for Promega :
5001 - 5050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the luciferase activity was measured using the dual- luciferase reporter assay system (E1910, Promega, Shanghai, China) on a fluorescent microplate reader (Molecular Devices Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... the luciferase activities of the cells were measured with a dual-luciferase reporter assay system (E1910, Promega) on a fluorescent microplate reader (Molecular Devices Inc) ...
-
bioRxiv - Immunology 2023Quote: ... 0.02 μg/μl Sequencing Grade Modified Trypsin (v511A, Promega) was added to the gel pieces and let to absorb for 20 minutes on ice ...
-
bioRxiv - Immunology 2023Quote: The total RNA extracted from BMMCs using a ReliaPrep RNA Cell Miniprep System (Promega) was reverse transcribed to cDNA with a ReverTra Ace qPCR RT Master Mix (TOYOBO ...
-
bioRxiv - Genomics 2023Quote: ... cells were lysed using Reporter Lysis Buffer (Promega) and the luciferase activity was measured using the Luciferase Assay System (Promega ...
-
bioRxiv - Genomics 2023Quote: ... and the luciferase activity was measured using the Luciferase Assay System (Promega, Cat # E4030) following manufacturer guidelines.
-
bioRxiv - Immunology 2023Quote: ... cells were lysed using BrightGlow Lysis Reagent (Promega E2620) and the RLU were measured by Tecan Spark® Luminometer ...
-
bioRxiv - Genomics 2023Quote: ... 4 mM DTT (Promega), and 1x CutSmart buffer (NEB ...
-
bioRxiv - Genetics 2023Quote: ... Transient expression of NSD2 VUS in HeLa cells was performed using FuGENE 6 (Promega, WI, USA). pCMV-3xFLAG-NSD2 and pCMV-3xFLAG-NSD2 c.2714C>T plasmids were constructed by VectorBuilder (IL ...
-
bioRxiv - Genetics 2023Quote: ... total RNA was extracted using the Eastep® Super Total RNA Extraction Kit (Promega). An equivalent of 1 μγ of RNA was reverse transcribed to synthesize cDNA using HiScript® II Q Select RT SuperMix (Vazyme Biotech) ...
-
bioRxiv - Genetics 2023Quote: ... The cells were then lysed by the Nuclei Lysis solution (Promega). Protein Precipitation Solution (Promega ...
-
bioRxiv - Genetics 2023Quote: ... Protein Precipitation Solution (Promega) was added to the lysed mixture ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes were treated with DNase (Promega) and purified by ammonium acetate precipitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 mM dNTP (Promega). Following random priming step ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA samples were treated with RNase-Free DNase I (Promega) at 37 °C for 30 min to remove any DNA residue ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL CellTiter-Flour (Promega) was added per well to measure cell viability and compounds toxicity ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Immunology 2023Quote: ... viral RNA (vRNA) was isolated from plasma samples using the Maxwell Viral Total Nucleic Acid Purification kit (Promega, Madison WI). Next ...
-
bioRxiv - Immunology 2023Quote: ... and the interferon stimulation response element (ISRE) (Promega), were also transfected into the cells ...
-
bioRxiv - Microbiology 2023Quote: Reduced and alkylated proteins were in-gel digested with 100ng trypsin (modified sequencing grade, Promega) overnight at 37° C ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was incubated in a plate reader (Amsterdam: Multiskan microplate photometer, Thermo Fisher; Ghent University: GloMax® Explorer Multimode Microplate Reader, Promega) at 37 °C and absorption was measured at 600 nm ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2023Quote: ... vigorously vortexed for 1 min and mixed with 40 μL of Proteinase K Solution (Promega France ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was removed and subjected to a Wizard Genomic DNA Purification Kit (Promega Catalog No. A1120) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNAseA (Thermo) and DNAseI (Promega) were used to treat nucleic acid extracts where indicated ...
-
bioRxiv - Microbiology 2023Quote: ... viral titers were determined by infecting MDCK cells and measuring reporter activity using the Nano-Glo luciferase assay (Promega)86,91 ...
-
bioRxiv - Microbiology 2023Quote: ... Caspase 3/7 enzymatic activity in raw cell lysates was measured using a Caspase Glo 3/7 assay kit (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Immunology 2023Quote: ... 100 μL supernatant was removed from each well and 30 μL of Bright-Glo (Promega #E2620) was added ...
-
bioRxiv - Immunology 2023Quote: ... pI.18-3xFlag-myRIG-I or pI.18-3xFlag-roRIG-I together with transfection control pLR-SV40-Renilla (Promega) and either of the reporter plasmids ISG54-Luc (69) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized using a MMLV reverse transcriptase (Promega, Madison, WI). Real-time PCR was performed using Radiant qPCR mastermix (Alkali Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2.5 μg pAdVantage (Promega), 30 μl of P3000 Reagent (Thermo Fisher Scientific) ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... FuGENE HD (Promega, E2311), AP20187 (Tocris™ 6297/5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1M Tris-HCl was added to adjust the pH and 5 μL trypsin (2.5 ug, Promega Sequence Grade) was added and the samples digested overnight at 37℃ ...
-
bioRxiv - Systems Biology 2023Quote: ... 200 μM dNTP (Promega, Madison, WI, USA), 2.5mM MgCl2 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.3 mg/ml boiled herring sperm DNA (Promega) with about 200 ng pWS174 digested with Esp3I (Cas9 plasmid) ...
-
bioRxiv - Microbiology 2023Quote: ... and TCID50 equivalents determined using a SARS-CoV-2 E gene detection kit (Promega) based upon the Berlin primer/ probe set (70).
-
bioRxiv - Molecular Biology 2023Quote: ... using SYBR qPCR master mix (Promega, Cat No. #4367659). All values were obtained in triplicate ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were harvested and lysed in Passive Lysis Buffer (Promega). The activity levels of the Renilla (RL ...
-
bioRxiv - Molecular Biology 2023Quote: ... The activity levels of the Renilla (RL) and firefly (FL) luciferase was measured using a Dual-Luciferase Assay (Promega). For mRNA decay assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gaussia luciferase activity in the supernatants was measured by addition of Coelenterazine (PJK Biotech) and firefly luciferase activity was measured in the cells using the Luciferase Assay System (Promega) according to the manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed in 100 μl 1x Passive Lysis Buffer (Promega). Gaussia luciferase activity in the supernatants was measured by addition of Coelenterazine (PJK Biotech ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... 10 µL of GoTaq Probe qPCR Master Mix (Promega, A6101) was added to 10 µL of the reaction mixture containing 125 nM each of the forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... 40 μl TnT® Quick Master Mix (L1170, Promega), 1 μl Methionine (1 mM) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from Tetrahymena WT (SB210, with or without BrdU-labeling) and ΔAMT1 cells using Wizard® Genomic DNA Purification Kit (Promega, A1120), sheared to 3-5kb in length with Megaruptor (Diagenode Diagnostics) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random primers (Promega, Charbonnières-les-bains, France).
-
bioRxiv - Neuroscience 2023Quote: ... The revers transcription (RT) reaction was performed by M-MLV reverse transcription kit (Promega, Madison, WI, USA).
-
bioRxiv - Neuroscience 2023Quote: ... 1ug of total RNA extracted from transfected SK-N-MC cells was reverse transcribed using the ImProm-II Reverse Transcription System and random hexamer primers (Promega, Madison, MI). PowerUp SYBR™ Green Master Mix (Thermo Fisher ...
-
α-synuclein expression in response to bacterial ligands and metabolites in gut enteroendocrine cellsbioRxiv - Neuroscience 2023Quote: Cell viability was assessed by Resazurin Reduction Assay (RRA) using a CellTiter-Blue® Cell Viability Assay (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... cells were processed with Bright-Glo luciferase system (Promega) according to the manufacturers protocol ...