Labshake search
Citations for Roche :
351 - 400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... the cells were harvested from the matrices by digesting the collagen with liberase DL research grade (24 U; Roche, Basel, Switzerland). The cells were then fixed with 4% PFA ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were harvested from the matrices by digesting the collagen with liberase DL research grade (24 U; Roche, Basel, Switzerland). The cells were then fixed with 4% PFA ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) supplemented with 1 complete protease inhibitor tablet (Roche). 40 mg/mL lysozyme was added to the pellets ...
-
bioRxiv - Biophysics 2024Quote: ... pH 7.4 supplemented with cOmplete Protease Inhibitor cocktail (Roche). The cells were lysed by sonication and the supernatant was centrifuged at 12,000rpm for 35 min at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... cell pellets from 2 L culture were resuspended in resuspension buffer (40 mM HEPES pH 7.5, 300 mM NaCl, with cOmplete protease inhibitor tablets (Roche)) and sonicated to break cell membranes ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were lysed in RIPA buffer with protease inhibitor (Roche, 04693159001), constant vortexed at 4 °C for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR amplification was performed in two technical replicates using KAPA Hifi Hotstart PCR kit (Kapa Biosystems, MA, USA) via a Bio-Rad CFX96 thermal cycler (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 100 mg/ml collagenase/dispase (Roche) in PBS for 45 min at 37 C ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was discarded, and 5 mL of Hank’s Balanced Salt Solution (Ca-, Mg-) (gibco) buffer containing liberase (Roche, #05401119001) (50 mg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... and quantified by qPCR (Roche, KR0405). Pooled samples were sequenced using MiSeq 2×300 bp paired end reads (Illumina ...
-
bioRxiv - Bioengineering 2024Quote: ... minced and dissociated using 1 mg/mL solution collagenase/dispase (Roche, 10269638001 and 11097113001) for 45 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; 11383221001, Roche) was performed in alkaline phosphatase reaction buffer [100 mM Tris pH 9.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1% IGEPAL-CA630) containing protease (cOmplete Mini, Roche) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were blocked for 30 min and then incubated in an alkaline phosphatase conjugated anti-DIG antibody (1:600, Roche). Slides were then washed and developed overnight in BCIP/NBT chromogen (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and by qPCR using KAPA Library Quantification Kit for Illumina® Platforms (Roche). Library size was determined with Agilent Bioanalyzer 2100 system using the Agilent High Sensitivity DNA Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... and by qPCR using KAPA Library Quantification Kit for Illumina® Platforms (Roche). Library size was determined with Agilent Bioanalyzer 2100 system using the Agilent High Sensitivity DNA Kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... the tissues were incubated with ERBB2 antibody (1:100 dilution, K00125, Roche) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... AATGATACGGCGACCACCGA-GATCTACACTCTTTCCCTACACGACGCTC and one of the SPLiT-seq sublibrary i7 index oligos BC0076-BC0083 combining 45 µL ADT cDNA with 50 µL 2x KAPA HiFi HotStart ReadyMix (Roche #KK2601) and 2.5 µL of 10 µM each PCR primer and ran the ADT-lib PCR cycle outlined in Table 5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 5 minutes on ice and re-suspended in DPBS with Protectorase (Roche #3335402001) and Superase (Invitrogen #AM2694 ...
-
bioRxiv - Cancer Biology 2024Quote: ... We performed PCR amplification using a standard KAPA HIFI mastermix protocol (Roche #KK2601) using a p5 custom library oligo ...
-
bioRxiv - Cancer Biology 2024Quote: ... the tissues were blocked with 10% bovine serum albumin (BSA) (Roche) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...
-
bioRxiv - Cancer Biology 2024Quote: ... The IHC process was conducted using the VENTANA Discovery Ultra system (Roche) following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by sequential staining with primary antibody for CD31 (Roche) and PLVAP (Proteintech) ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing protease inhibitor (Complete – EDTA-free, Roche) and 1 mM Na3VO4 ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with protease inhibitor cocktail (Roche, 11697498001) and 1 mM PMSF (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... Protease Inhibitor from Roche (11697498001). Wildtype human adenovirus species C2 (HAdV-C2WT ...
-
bioRxiv - Cell Biology 2024Quote: Cells were lysed in reducing Laemmli SDS sample buffer containing PhosSTOP (Phosphatase Inhibitor Cocktail Tablets, Roche, Switzerland) at 96°C for 10 min and the proteins separated on NuPAGE® Novex® 4–12% Bis–Tris Gels ...
-
bioRxiv - Cell Biology 2024Quote: ... and complete protease inhibitors (Roche)) on ice for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantified by using Qubit 2.0 Fluorometer as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a single lane of a flow cell ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.1% SDS) supplemented with Roche Complete Protease Inhibitor Cocktail with EDTA (Roche, #11836153001), PhosStop (used at 2x ...
-
bioRxiv - Cell Biology 2024Quote: ... PhosStop (used at 2x, Roche, #PHOSS-RO), 11 mg/mL β-glycerophosphate (from a 110-mg/mL 10x stock solution) ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with cOmplete protease inhibitor cocktail (Roche). Lysed cells were centrifuged for 10 min at 14,000 g and 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: mouse anti-GFP (#11814460001, Roche) rabbit anti-TACC (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... resuspended in binding PBS buffer supplemented with Complete EDTA-free Protease inhibitor Cocktail (Roche) and lysed using an Emulsiflex-C5 homogeniser (Avestin) ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Light Cycler 96 system (Roche, Basel, Switzerland; Exp. 2). The species-specific primer-probe set for each target region of Ayu was shown in Table 1 (see Result) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were detected with anti-HA antibody (Roche, Cat#11867423001).
-
bioRxiv - Microbiology 2024Quote: ... EDTA-free Protease inhibitor cocktail (Roche, USA). Cell lysis was accomplished by using a FisherbrandTM Model 505 Sonic Dismembrator (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 mg DNaseI (Roche) and incubated for 30 min on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% SDS and 125mM sucrose) supplemented with Phos-STOP and protease inhibitors (Roche). A BCA Protein Assay kit (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... nmbb and nts probes (11175025910, Roche) and fluorescein (FITC)-labeled in vitro transcription of rln3a and sst1.1 probes (11685619910 ...
-
bioRxiv - Neuroscience 2024Quote: ... Whole mount larvae and adult brain sections layered on glass slides were blocked for at least one hour in PBT with 2 mg/ml bovine serum albumin and 2% sheep serum at room temperature and then incubated overnight at 4°C with alkaline phosphatase-coupled anti-DIG antiserum (11093274910, Roche) diluted 1/5000 in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... and 250 mg or 500mg protein was digested with 20 µg/ml proteinase K (PK) (Roche) for PrPSc blots for 1 hour at 37C ...
-
bioRxiv - Neuroscience 2024Quote: ... anesthesia was antagonized by a mixture of flumazenil (0.5 mg/kg; Anexate, Roche) and atipamezole (2.5 mg/kg ...
-
bioRxiv - Neuroscience 2024Quote: ... midazolam (5.0 mg/kg; Dormicum, Roche), and medetomidine (0.5 mg/kg ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time qPCR was carried out by KAPA Library Quantification Kit (KR0389, KAPA Biosystems). Primer sequences are provided in Table S1.
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were digested for 30 minutes and dissected adult brains for 35 minutes in proteinase K (3115836001, Roche; 10 μg/ml in PBT). To stop the reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were incubated overnight at 4°C in alkaline phosphatase-coupled anti-FITC antiserum (11426338910, Roche) diluted 1:5000 in blocking buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... and blocked for 1 hour in blocking buffer consisting of 20% sheep serum and 2% blocking reagent (11096176001, Roche) in MABT ...