Labshake search
Citations for Roche :
201 - 250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... the lysis buffer was supplemented with the cOmplete protease inhibitor cocktail (Roche). The cell suspension underwent sonication through 5 cycles at 40% power for 4 pulses each ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR amplification of cut site regions was performed with KAPA HiFi polymerase (Kapa Biosystems) according to the manufacturer-provided protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... The treated lymphoma cells were cooled down by addition of the three-fold volume of ice-cold DPBS supplemented with 1xPhosSTOP (Roche) and 100µM sodium orthovanadate ...
-
bioRxiv - Systems Biology 2024Quote: ... HA (Roche, 11867423001, 1:1000 dilution); IKK2 (Cell Signaling Technology ...
-
bioRxiv - Systems Biology 2024Quote: ... and proteases (cOmplete Mini Roche, Basel, CH) and protein was isolated using RIPA buffer.
-
bioRxiv - Immunology 2024Quote: ... cOmplete protease inhibitor (1 tablet / 10 ml) (Roche, 11697498001). Protein lysates were resolved on a NuPAGE™ 4 to 12% ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested using corresponding inhibitors of phosphatases (PhosSTOP Roche, Basel, CH) and proteases (cOmplete Mini Roche ...
-
bioRxiv - Synthetic Biology 2024Quote: ... qPCR reactions were carried out on LightCycler 480 II (Roche). Quantification of RNA expression was normalized to ACTB (unless otherwise specified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Colony PCR is performed using Kapa Robust (Roche) using a single colony diluted in 100μL of dH2O ...
-
bioRxiv - Synthetic Biology 2024Quote: ... These barcode primers were combined separately with another constant primer to create short double-stranded fragments containing the barcode flanked by BsaI cut sites in a single cycle of PCR using Kapa HiFi (Roche). 1μL of this reaction was added into a second Kapa HiFi (Roche ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Kapa HiFi mix (Roche) for 14 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1μL of this reaction was added into a second Kapa HiFi (Roche) reaction with additional primers to increase the length of the amplicon over 18 cycles ...
-
bioRxiv - Systems Biology 2024Quote: The qPCR reactions underwent purification using SPRI size selection with Kapa Pure Beads (Roche) at specific ratios of 0.8× and 0.7× to eliminate fragments smaller than 300bp ...
-
bioRxiv - Systems Biology 2024Quote: ... with protease and phosphatase inhibitors (Roche). Protein concentration was determined with a micro-BCA assay (Pierce) ...
-
bioRxiv - Systems Biology 2024Quote: ... The lungs were perfused through the pulmonary artery and inflated via the airway with DMEM containing 1 mg/ml Collagenase/Dispase (Roche), 3 U/ml Elastase (Worthington) ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Microbiology 2024Quote: ... The probes were produced by NimbleGen SeqCap EZ (Roche NimbleGen, Inc., Madison, USA), with biotin labelling to enable retrieval of the hybridized targets using streptavidin coated magnetic beads (Kushwaha et al. ...
-
bioRxiv - Microbiology 2024Quote: ... and purified with the High Pure PCR product purification kit (Roche). Sequencing indexes were added by LGC ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were extracted by resuspending cells from 6-well plates in 100 μl of RIPA or 7M Urea Buffer containing protease inhibitor (11873580001, Roche) and ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor (04906837001, Roche). Cell lysates were centrifuged at >14 000 x g for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1 % SDS) supplemented with cOmplete™ EDTA-free Protease Inhibitors (11836170001; Roche). 30 µl of protein A or G paramagnetic beads (73778S or 9006S ...
-
bioRxiv - Neuroscience 2024Quote: ... SYBR Green (PB20.11-05, PCR Biosystems) was used on a real-time thermal cycler (LightCycler® 480, Roche). S16 or HPRT were used as internal control gene ...
-
bioRxiv - Neuroscience 2024Quote: ... After rebuffering in lactose AAV titers were determined by real-time PCS on vector genomes using the SYBR Green Master Mix (Roche Molecular Systems).
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were suspended in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Nonidet P-40, 0.5% NaDeoxycholate, 0.1% SDS, 1x Roche protease inhibitor mixture) and sonicated 5 times x 5 min (30 s ON/ 30 s OFF ...
-
bioRxiv - Molecular Biology 2024Quote: Beads were then washed twice with Low Salt Wash Buffer (150 mM NaCl, 0.1 % SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8, 1x Roche protease inhibitor mixture), twice with High Salt Wash Buffer (500 mM NaCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.44 M sucrose, 1.25 % Ficoll, 2.5% Dextran, 10 mM MgCl2, 0.5% Triton X-100, 5 mM DTT, 1x Roche protease inhibitor mixture), filtered through two layers of Miracloth ...
-
bioRxiv - Molecular Biology 2024Quote: ... and twice with TE wash buffer (10 mM Tris-HCl pH 8, 1 mM EDTA, 1x Roche protease inhibitor mixture).
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellet was suspended in 1 mL of TAP buffer (100 mM NaCl, 20 mM Tris-HCl pH 8, 2.5 mM EDTA, 10 % glycerol, 1 % Triton, 1x of PhosSTOP, 1x Roche protease inhibitor mixture) and given 20 strokes with the Dounce Homogenizer ...
-
bioRxiv - Molecular Biology 2024Quote: ... treated with Proteinase K (Roche) for 1 h at 45°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then dephosphorylated using the alkaline phosphatase rAPid (Roche). A target-specific gRNA was designed using CRIPR-P 2.0 (http://crispr.hzau.edu.cn/CRISPR2) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... prepared for sequencing using a KAPA HyperPrep kit (Roche) and sequenced on an Illumina MiSeq system ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Kapa Hifi HotStart Ready mastermix (Roche) was used for the PCR reactions with the following primer sets (Supplementary Table 14) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was amplified using F3 and R3 primers (Supp. Table 2) and KAPA-Hifi polymerase (Roche). Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter) ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS) and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using a KAPA HyperPrep PCR-Free kit (Roche, Basel Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we prepared libraries using the Hyper Library construction kit (Kapa Biosystems) tagging them with unique dual-end adaptors ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.6% transferrin (Roche, 10652), 50 ug/ml ascorbic acid (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the KAPA Library Quantification Kit (Roche Cat. # 7960140001). Finally ...
-
bioRxiv - Developmental Biology 2024Quote: ... transferrin (Roche), 0.03% monothioglycerol (MTG ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.5% w/v bovine serum albumin fraction V (Roche), 0.4 mg/L amphotericine B (Fungizone® ...
-
bioRxiv - Biochemistry 2024Quote: ... Coverslips were then incubated with the anti-myc antibody (11667149001 9E10 mAb from Roche; 1:250 in blocking buffer) for two hours at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were then washed with PBS for three times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche) on ice for 10 min ...
-
bioRxiv - Immunology 2024Quote: ... and 1X protease inhibitor cocktail (Roche 11836170001). Sonication was performed in a Covaris M220 (75% PIP ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were quantified using KAPA Library Quantification Kits (Kapa Biosystems). After cluster generation on a cBot ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Biochemistry 2024Quote: ... and LightCycler 96 (Roche). mRNA transcript abundance was normalized to that of Actb ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 mM 2-mercaptoethanol] containing one tablet of protease inhibitor cocktail (Roche), which can inhibit a broad spectrum of serine and cysteine proteases ...
-
bioRxiv - Neuroscience 2024Quote: ... brain slices were permeabilized by 0.3% triton in PBS and positive control slices were incubated with Dnase I recombinant (Roche, Basel, Switzerland, #4536282001) (1,000 units) ...