Labshake search
Citations for Roche :
151 - 200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and phosphatase inhibitor (Roche Diagnostics, catalog #04906845001) mixtures at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.1%) supplemented with protease inhibitor cocktail 1x (Roche, 11873580001), phosphatase inhibitors 1x (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 250 mmol/L NaCl) containing protease inhibitor cocktail tablets (Roche). Samples were run alongside a Chameleon Duo protein ladder and transferred to nitrocellulose membranes ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the X-tremeGENE HP DNA Transfection Reagent (Roche). After filtration through a 0.45 μm filter ...
-
bioRxiv - Neuroscience 2024Quote: ... mechanically dissociated in a single cell suspension in media containing DNase I (Roche, 100 ug/ml) using repeated pipetting and concentrated by centrifugation (3 min at 800 X g) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and NBT/BCIP (1:500, Roche, 11681451001). After hybridization ...
-
bioRxiv - Immunology 2024Quote: ... DNAse I (Roche, Cat#04416728001) 10 ug/ml and 1.5 mM Calcium Chloride ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the libraries were quantified by Kapa qPCR (Roche). Pooled libraries were subjected to 150 bp paired-end sequencing according to the manufacturer’s protocol (Illumina NovaSeq 6000) ...
-
bioRxiv - Neuroscience 2024Quote: ... .5 µL of a 10 µM primer mix and 7.5 µL of Fast Start SYBR Green Master Mix (Roche). Each reaction was performed in triplicate ...
-
bioRxiv - Microbiology 2024Quote: ... the probes were synthesized by Roche, though the probe set was not specifically tailored to their technology and could be synthesized by other manufacturers ...
-
bioRxiv - Cancer Biology 2024Quote: ... and PhoSTOP (Roche, Cat# 04906837001). Protein concentration was determined using Pierce 660 nM Protein Assay Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: Resected tumors were cut into small pieces using spring scissors and digested in 0.5 mg/mL collagenase D (Roche: cat#: COLLD-RO) and 0.25 mg/mL DNase I at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and signal development using Discovery FITC (RTU, Roche-Ventana Medical Systems ...
-
bioRxiv - Cancer Biology 2024Quote: ... and signal development using Discovery Cy5 Kit (RTU, Roche-Ventana Medical Systems ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed with cold PBS containing protease inhibitors (Roche, #5056489001), scraped off the plates ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.25% Triton X-100 and 1× protease inhibitor (Roche, #5056489001)) and placed on a rotator (10 min at 4 °C) ...
-
bioRxiv - Plant Biology 2024Quote: ... then 15 μl of 20 mg/ml Proteinase K (Roche #46950800/Sigma #3115887001) per sample was added and the tissue was ground again ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.1% (v/v) Triton X-100) supplemented with cOmplete EDTA-free protease inhibitors (Roche, Basel, Switzerland). To the pellet of 107 of P ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM beta-mercaptoethanol) in the presence of a protease inhibitor cocktail (Roche, Basel, Switzerland). These mixtures were incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... co-cultures were treated every 48 h from the start of co-culture with either 1 µM LGMN inhibitor (Roche) or a DMSO control for three weeks.
-
bioRxiv - Synthetic Biology 2024Quote: 2 mg of the isolated RNA was digested with DNAse I (Roche) and cDNA was synthesized using the GoScript reverse transcription kit A5001 (Promega) ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatants were supplemented with a protease inhibitor cocktail (Complete ultra, Roche, Sigma-Aldrich) and stored at −80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... for all qPCRs except C9orf72 variant 2 expression levels for which TaqMan probes were used (sequences provided in Table S2) and measured with a LightCyclerTM (Roche). qPCR was performed in technical triplicate with data normalised to GAPDH expression levels.
-
bioRxiv - Biophysics 2024Quote: ... protease inhibitor (Roche) followed with subsequent wash steps using the ultracentrifuge ...
-
bioRxiv - Microbiology 2024Quote: ... BHK cells were transfected with 3 μg of pBAC-SARS-COV-2 construct and1 μg of SARS-CoV-2 N (Delta) plasmid with the X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 ...
-
bioRxiv - Microbiology 2024Quote: ... The blot was incubated with a chemiluminescence kit (Roche 12015200001, Thermo Scientific™ 34096) and images were captured using ChemiDoc™ Imaging System (Biorad 12003153) ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Immunology 2024Quote: ... and 30 µg/mL DNase I (Roche). Lung cells were dissociated using the GentleMACS (Miltenyi Biotec ...
-
bioRxiv - Immunology 2024Quote: ... they were digested with DNAse I (30 IU/mL, Roche) and Collagenase D (1 mg/mL ...
-
bioRxiv - Immunology 2024Quote: ... and Liberase (Roche)) for 45 minutes in an incubator at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... each sample was incubated with 10 μL of RNAse A (Roche Diagnostics GmbH ...
-
bioRxiv - Microbiology 2024Quote: ... Sonicated cells were then digested with 6μL RNaseA (SIG 10109169001, Sigma-Aldrich/Roche, 10mg/mL), 5.4 μL of 100mM MnCl2 ...
-
bioRxiv - Systems Biology 2024Quote: ... 0.5mM EDTA supplemented with Proteinase Inhibitor (Roche) and protein concentration was determined photometrically using the Protein Assay Dye Reagent Concentrate (BioRad) ...
-
bioRxiv - Systems Biology 2024Quote: ... iPCR amplification was carried out with KAPA HiFi HotStart ReadyMix (Roche), and a specific primer pair (AATGATACGGCGACCACCGAGATCTACACGAGCCAGAACCAGAAGGAACTTGA*C ...
-
bioRxiv - Systems Biology 2024Quote: ... Single cell clones were afterwards transduced with a retroviral vector for the expression of pMSCV_hygro_CreERT2 and selected with 250 µg/ml Hygromycin (Roche) followed by single cell clone selection.
-
bioRxiv - Systems Biology 2024Quote: ... washed with 1xPBS and lysed in 100 µl RIPA buffer containing protease inhibitor (Roche) and Benzonase (Sigma Aldrich) ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 mM EDTA and 0.5% Triton X-100 containing cOmplete Mini protease inhibitor (Roche) via 3 rounds of probe ultrasonication ...
-
bioRxiv - Systems Biology 2024Quote: ... then 5 min at 62°C) with KAPA HiFi HotStart Ready Mix (Roche). Libraries were quantified by Bioanalyzer (Agilent ...
-
bioRxiv - Systems Biology 2024Quote: ... strand-specific RNA-seq library was built with the KAPA RNA Hyper Prep kit (Kapa Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... and 100 µL of RIPA buffer with 1 µL of 100x protease inhibitor cocktail (Roche) was added before homogenization using 400 µm LoBind silica beads (0.3-0.4 mg ...
-
bioRxiv - Systems Biology 2024Quote: ... Shotgun metagenomic sequencing libraries were prepared using a miniaturized version of the Kapa HyperPlus Illumina-compatible library prep kit (Kapa Biosystems). DNA extracts were normalized to 5 ng total input per sample using an Echo 550 acoustic liquid handling robot (Labcyte Inc) ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting products were then subjected to size selection with Kappa Pure Beads (Roche) at specific ratios of 0.7× and 0.6× ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... for PCRs KAPA HiFi HS RM (Roche) and different primer sets spanning regions out and/or inside expected deletions were used ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... Upon quantification with Universal KAPA Library Quantification Kit for Illumina (Roche) Libraries were pooled and sent for sequencing.
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using the Light Cycler 480 SYBR green I Master kit (Roche, Cat# 04887352001). The primers used for RT-qPCR are listed in the Key Resource Table ...
-
bioRxiv - Systems Biology 2024Quote: ... 2.2 % (wt/vol) SDS) supplemented with complete™ EDTA-free (Roche Diagnostics, Mannheim, GER) as protease inhibitor ...
-
bioRxiv - Systems Biology 2024Quote: ... LDH released in the supernatant was detected using a cytotoxicity detection kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: We amplified the cDNA using 2× Kapa HiFi HotStart ReadyMix (Roche), a high-fidelity polymerase enzyme ...