Labshake search
Citations for Roche :
2701 - 2750 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Roche Life Science). STR DNA genotyping at DSMZ was carried out as described previously using a nonaplex PCR reaction of eight highly polymorphic STR loci plus Amelogenin-based gender determination (Dirks and Drexler 2013) ...
-
bioRxiv - Plant Biology 2019Quote: Quantitative real-time PCR was performed on a LightCycler 480 system (Roche, Indianapolis, IN, USA) using Ta4045 gene as internal reference (Paolacci et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR (qPCR) amplification was carried out on a LightCycler 480 II (Roche Applied Sciences) using touchdown PCR and terminated after reaching the plateau stage in order to minimize primer dimer formation ...
-
bioRxiv - Genetics 2020Quote: ... The qRT-PCR was performed using LightCycler® 480 SYBR Green I Master (Roche, Germany) and target gene expression normalized to Rpl5 and analysed using the ΔΔCT method [51].
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Physiology 2020Quote: ... The qRT-PCR was performed with the LightCycler 480 SYBR Green I Master mix (Roche) using the following primer pairs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Paired-end libraries were prepared with the PCR-free KAPA Hyper Prep Kit (KAPA Biosystems). The 150 bp paired-end reads were sequenced with Illumina HiSeq2500 at the Genomics Facility Basel to a mean coverage of 23 (range 18–38 ...
-
bioRxiv - Genomics 2020Quote: ... Immunoprecipitates were analyzed by real-time PCR using the Roche Universal Probe Library (Roche Diagnostics) and the Universal Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the FastStart Essential DNA Green Master (Roche, Mannheim, Germany) and a Light Cycler Nano instrument (Roche ...
-
bioRxiv - Genetics 2021Quote: ... Quantitative real-time PCR was performed using a Roche LightCycler 480 Instrument II (Roche Diagnostics) with SYBR green dye (#172-5125 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time quantitative PCR analyses were performed using the Light Cycler LC 1.5 (Roche, France). For each condition ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The December samples were examined by Light Cycle 480II fluorescent PCR instrument (Roche, Basel, Switzerland) for investigating 26 respiratory pathogens and detection of the virus using Severe Acute Respiratory Syndrome Cov (SARS-Cov ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We performed a two-steps PCR protocol on a LifeCycler® 480 (Roche Life Science), using the following program ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... cDNA was amplified for 20 cycles using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems). Aliquots of the amplified cDNA were also used for antibody cloning later ...
-
bioRxiv - Microbiology 2020Quote: ... Total genomic DNA was extracted using the High Pure PCR Template Preparation Kit (Roche, Germany) according to the manufacturer’s instructions and the 16S rRNA gene of the isolate was amplified by PCR using 27F:AGAGTT TGATCMTGGCTCAG (Wilmotte et al. ...
-
bioRxiv - Microbiology 2020Quote: ... A probe for mGFP ORF was generated using the PCR DIG Synthesis Probe Kit (Roche) and primers P35-P36 (Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCRs were performed on a LightCycler 480 II using LightCycler 480 SYBR Green (Roche).
-
bioRxiv - Immunology 2020Quote: ... q-PCR was performed using the Smart SYBRGreen fast Master kit (Roche Diagnostics, Meylan, France) and a CFX Touch RTPCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... index PCR was performed with 12.5 μL of KAPA HiFi HotStart ReadyMix (2x) (Kapa Biosystems), each 1 μL of 10 μM forward and reverse primers from Nextera XT Index Kit v2 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 1st PCR was performed with 12.5 μL of KAPA HiFi HotStart ReadyMix (2x) (Kapa Biosystems), 0.5 μL of 10 μM forward primer (5 ‘-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNATGGCTGAGGTGCAGCTCG TG-3 ‘) ...
-
bioRxiv - Immunology 2021Quote: ... The final library concentrations and qualities were determined by both SYBR PCR (Kapa Biosystems, #KK4824) with a BioRad CFX qPCR machine and Bioanalyser (High Sensitivity DNA assay ...
-
bioRxiv - Immunology 2021Quote: ... Real-time quantitative PCR was performed with either FastStart Universal Prove Master Mix (Roche Diagnostics) using ViiA 7 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: ... The real-time PCR reactions were carried out in a LightCycler 480 machine (Roche, Switzerland) in a 20 μL system with a mixture of 10 μL 2×SYBR Premix ExTaq (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... PCR was carried out using KAPA SYBR FAST qPCR Kit Master Mix (KAPA BIOSYSTEMS, KK4602) and primer sets (Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... Library molarity was measured via quantitative PCR with the KAPA Library Quantification Kit (Roche KK4824) on a BioRad CFX Connect thermal cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... All subsequent PCR reactions were prepared using the KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2602). A second strand PCR was performed with a primer binding upstream of the intron sequence which is part of candidate mRNAs (2nd_strand_primer_fw ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNA was extracted using the High Pure PCR template preparation kit (Roche, Cat# 11796828001) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... and qRT-PCR was performed using KAPA SYBR FAST Master Mix (2X) Universal (Kapa Biosystems) and the Thermal Cycler Dice Real Time System (Takara) ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were purified using the High Pure PCR Production Purification Kit (11732676001, Roche / Sigma-Aldrich). Libraries were validated on an Agilent 2100 and quantified using quantitative PCR (Q-PCR) ...
-
bioRxiv - Genetics 2022Quote: ... PCR was performed in 12 μL containing 6 μL Kapa HRM-Fast Master mix (Roche), supplemented with 1.5 mM MgCl2 ...
-
bioRxiv - Genetics 2022Quote: ... cinerea genomic DNA using the KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, MA, USA). The PCR thermocycling profile used was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the high-throughput Light Cycler 480 II Real-Time PCR system(Roche, Germany, Mannheim). cDNA samples were diluted with Nuclease Free Water (1:5) ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was carried out on a LightCycer480-II System (Roche Diagnostics, Penzberg Germany) by using SYBR Premix Ex Taq TM (TAKARA ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were prepared with the purified PCR product by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Real time quantitative PCR were performed using LightCycler 480 SYBR Green I Master Mix (Roche) and the transcript levels of MycFOLD-2 ...
-
bioRxiv - Immunology 2022Quote: ... Both PCR amplifications were done with KAPA Real-time library Amp kit (Roche, Wilmington, MA) with a cycle condition ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative real-time PCR was performed using a Roche LightCycler 480 Instrument II (Roche Diagnostics) with SYBR green dye (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... Library molarity was measured via quantitative PCR with the KAPA Library Quantification Kit (Roche KK4824) on a BioRad CFX Connect thermal cycler ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR reactions were performed on a LightCycler 480 Instrument II (Roche Life Science) using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for high throughput sequencing were made by PCR using KAPA HiFi HS ReadyMix (Roche) from genomic DNA (Qiagen blood and tissue kit ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Real-time PCR analysis was performed with the LightCycler 480 SYBR Green I Master (Roche) using the ABI Prism 7500 Sequence Detection System instrument ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR reactions were carried out in triplicate with SYBR Green I Master Mix (Roche) on a LightCycler 480 system (Roche) ...
-
bioRxiv - Pathology 2024Quote: ... Real-time PCR was performed using a LightCycler 96 instrument (Roche Diagnostics GmbH, Mannheim, Germany). FAP mRNA expression level was normalized to that of β-actin.
-
bioRxiv - Plant Biology 2024Quote: ... Real-time quantitative PCR assays were prepared using KAPA SYBR FAST qPCR kit (Kapa Biosystems) and run on an Applied Biosystems QuantStudio 12K QPCR instrument ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using the KAPA SYBR Fast qPCR Master Mix (KAPA Biosystems) on the StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... and libraries were constructed using on-bead PCR amplification using the KAPA HyperPlus kit (Roche). The constructed libraries were then sequenced using the Illumina NovaSeq 6000 platform (paired-end 50 bp reads ...
-
bioRxiv - Genomics 2024Quote: ... Oligo pool amplification PCRs were assembled with 1X KAPA HiFi HotStart Ready Mix (Roche KK2601), 1X EvaGreen qPCR dye (Biotium 31000) ...
-
bioRxiv - Microbiology 2024Quote: Total DNA isolated using the High Pure PCR Template Preparation Kit (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions was used as a template for nested PCR amplification (detection limit 10-2 parasites per sample ...
-
bioRxiv - Microbiology 2023Quote: ... Library molarity was measured via quantitative PCR with the KAPA Library Quantification Kit (Roche KK4824) on a BioRad CFX Connect thermal cycler ...
-
bioRxiv - Biochemistry 2024Quote: ... Four replicate PCRs were carried out with HiFi HotStart Ready Mix (Kapa Biosystems, Wilmington, MA) and SYBR Green fluorescent dye (Applied Biosystems ...