Labshake search
Citations for Roche :
2551 - 2600 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... mRNA levels were measured by quantitative PCR by using a LightCycler480 (Roche, Rotkreuz, Switzerland) using specific Taqman probes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR amplification of cut site regions was performed with KAPA HiFi polymerase (Kapa Biosystems) according to the manufacturer-provided protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... and amplified using firstly a nested PCR reaction with KAPA HiFi HotStart ReadyMix (Roche), and a specific primer pair (TGCAGGACCGGACGTGACTGGAGTTC*A ...
-
bioRxiv - Physiology 2024Quote: ... Gene expression was determined by qRT-PCR on Light Cycler 480II (Roche, Mannheim, Germany) using 2.5 μl cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real-time quantitative PCR (qPCR) analysis was performed using a LightCycler®480 (Roche), with a first cycle at 95°C for 2 min ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2024Quote: Liver genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Roche), followed by RNAse A treatment ...
-
bioRxiv - Developmental Biology 2023Quote: Quantitative PCR was performed with the LightCycler 480 SYBR Green I Master (Roche 04707516001) on a Real-Time PCR System (LightCycler® 480 (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time PCR was conducted on a Light Cycler 480 II (Roche, Mannheim, Germany) using ChamQ SYBR qPCR Mix (Q711 ...
-
bioRxiv - Microbiology 2024Quote: ... samples were collected and plasma HIV RNA levels tested by quantitative rRT-PCR (Roche Cobas Ampliprep/Cobas Taqman HIV-1 test ...
-
bioRxiv - Cell Biology 2023Quote: Real-time PCR was performed using the LightCycler 480 SYBR Green Master Kit (Roche). The sequences of the primers used are shown in Fig ...
-
bioRxiv - Genomics 2024Quote: ... adapter ligation and PCR amplification was performed using the Kapa Hyper Prep kit (Roche). Beads were resuspended in 60 µL of a cocktail containing 50 µL H2O ...
-
bioRxiv - Microbiology 2024Quote: ... Real time qPCR was performed with SYBR® green PCR master mix (KAPA biosystems) or HotStart™ 2X SYBR Green qPCR Master Mix (APExBIO Technology) ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative PCR was performed using FastStart Universal SYBR Green Master mix (Roche, Basel, Switzerland) on an iCycler real-time PCR system (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2024Quote: ... Whole transcriptome amplification was carried out using KAPA HiFi PCR Mastermix (Kapa Biosystems KK2602) with 2000 beads per 50-μl reaction volume ...
-
bioRxiv - Bioengineering 2024Quote: ... Products were amplified by PCR with the Kapa HiFi polymerase (Kapa Biosystems, Wilmington, MA), and libraries were quantified by qPCR (Kapa Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the resulting cDNA was examined by real-time PCR (LightCycler 480 II, Roche). The cycle threshold (Ct ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were done using Taq DNA polymerase (Roche Life Science or Thermo scientific) according to the manufacturer’s recommendations and using 1 μl of cDNA as a template with the following program ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative real-time qPCR was performed in a LightCycler480 real-time PCR system (Roche) using TaqMan Gene Expression Assays (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Each sample was amplified in triplicate on the 480 Real-Time PCR system (Roche) using SYBR Premix Ex Taq II (Takara ...
-
bioRxiv - Immunology 2023Quote: ... Whole transcriptome amplification (WTA) was performed with KAPA HiFi PCR Mastermix (Kapa Biosystems KK2602) using approximately 6,000 beads per 50 μL reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... and qPCR performed using Fast SYBR Master Mix (PCR Biosystems) in a LightCycler96 (Roche) with the primers listed above ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and qPCR was performed with the Roche COBAS Ampliprep PCR system (Roche, IN, USA). The detection range was from 20 to 1.7◊108 IU/mL.
-
bioRxiv - Neuroscience 2023Quote: ... The resulting sgRNA was purified using the High Pure PCR Cleanup Microkit (Roche, 498395500). 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio ...
-
Transcriptional analysis in multiple barley varieties identifies signatures of waterlogging responsebioRxiv - Plant Biology 2023Quote: ... Each PCR reaction mix contained 5 μL of 2x SYBR green master 1 (Roche), 1 μL cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Unique Fluidigm sample barcodes were added using Fast Start High Fidelity PCR System (Roche). Library was balanced based on the Bioanalyser molarity ...
-
bioRxiv - Microbiology 2023Quote: ... We re-circularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed using a RealTime PCR LightCycler 96 ® system (Roche Life Sciences). EC positive for UTY expression were classified male ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR quantification was performed using Cobas z 480 analyzer (Roche Diagnostics GmBH). The threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA samples were used for quantitative PCR in the LightCycler 96 system (Roche) using the FastStar Essential DNA Green Master (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR and qRT-PCR was performed using LightCycler 480 SYBR Green I Master (Roche). The thermal cycling conditions were 95°C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time PCR was carried out using FastStart Universal SYBR Green Master Mix (Roche) on a CFX 384 Bio-Rad thermal cycler (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... Gene expression was determined by quantitative real-time PCR using LightCycler® 96 (Roche). Relative gene expression was determined using ΔΔCT method ...
-
bioRxiv - Neuroscience 2023Quote: ... Gene expression was determined by quantitative real-time PCR using LightCycler® 96 (Roche). Relative gene expression was determined using ΔΔCT method ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed using the LightCycler 480 SYBR Green I Master system (Roche) with the housekeeping genes Actin 42A and Tubulin 84B as references ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The reaction procedure in a LightCycler® 480 Real-Time PCR System (Roche Diagnostic) was ...
-
bioRxiv - Cell Biology 2022Quote: ... Using a two-step nested PCR with KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems), sgRNA expression cassettes were amplified ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative Real time PCR was performed using FastStart universal SyBR Green Master Mix (Roche) in 7500 Fast Real-time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... The additional mutation in construct M1 (P234G) was generated by PCR (Pwo Master; Roche) using primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Quantitative PCR was performed using FastStart DNA SYBR Green on LightCycler 1.5 (Roche Diagnostics), with primer set of 5’-AGACAGTGGTTGCCTACGGG-3’ and 5’-ATGCGAAGTGTCCCATGAGC-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression level was quantitatively monitored using real-time PCR (LightCycler 480, Roche, Switzerland) with SYBR Green I Master (Roche ...
-
bioRxiv - Genomics 2023Quote: The first PCR was carried out using the KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with 5 ng of the sheared gDNA and 0.3 μM concentration of each primer in 20 μL reaction volume at [98°C for 3 min ...
-
bioRxiv - Immunology 2023Quote: ... Real-time PCR was performed using LightCycler® 480 SYBR Green I Master (Roche). Gene-specific primers used are described in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed using FastStart Essential DNA Green Master Mix (Roche, Cat#06924204001) on a Roche Light cycler 96 in 96 well plates ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Each sample was amplified in triplicate on the 480 Real-Time PCR system (Roche) using SYBR Premix Ex Taq II (Takara ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was PCR amplified with KAPA HiFi Hot Start Ready Mix (Roche, cat.no. KK2601) using cDNA FWD primer and cDNA REV primers (see Table 3) ...
-
bioRxiv - Bioengineering 2023Quote: ... nested PCRs were performed on each DNA sample using the HiFi KAPA polymerase (Roche). Following Illumina barcoding (Nextera indices ...
-
bioRxiv - Molecular Biology 2023Quote: DNA amplification was obtained by PCR with either KAPA HiFi HotStart ReadyMix (Roche KK2601) or Q5 High-Fidelity 2X Master Mix (New England Biosystems #M0492 ...
-
bioRxiv - Genomics 2023Quote: ... Post-tagmentation PCR (12 cycles) was done in 40μL reactions using KAPA HiFi (Roche). The manufacturer’s recommendations were followed by adding 24μL Mastermix ...
-
bioRxiv - Immunology 2023Quote: ... The resulting cDNA was used as template for High Fidelity PCR amplification (KAPA, Roche) using a set of 6 FR1-specific forward primers59 including sample-specific barcode sequences (6 bp ...