Labshake search
Citations for Roche :
2601 - 2650 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: First-round L-PCRs were performed using KAPA HiFi HotStart ReadyMix (Roche Molecular Systems). Reactions (50 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR was performed with the KAPA2G Fast HotStart ReadyMix (Roche, Switzerland, #KK 5609).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Each sample was amplified in triplicate on the 480 Real-Time PCR system (Roche) using SYBR Premix Ex Taq II (Takara ...
-
bioRxiv - Genomics 2023Quote: ... Quantification of chromatin immunoprecipitation was performed by real time PCR using Roche Lightcycler (Roche). The fold enrichment of target sequence in the immunoprecipitated (IP ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Cell Biology 2023Quote: Real-time PCR was performed using the LightCycler 480 SYBR Green Master Kit (Roche). The sequences of the primers used are shown in Fig ...
-
bioRxiv - Physiology 2024Quote: ... Gene expression was determined by qRT-PCR on Light Cycler 480II (Roche, Mannheim, Germany) using 2.5 μl cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: Quantitative PCR was performed with the LightCycler 480 SYBR Green I Master (Roche 04707516001) on a Real-Time PCR System (LightCycler® 480 (Roche ...
-
bioRxiv - Systems Biology 2024Quote: ... and amplified using firstly a nested PCR reaction with KAPA HiFi HotStart ReadyMix (Roche), and a specific primer pair (TGCAGGACCGGACGTGACTGGAGTTC*A ...
-
bioRxiv - Molecular Biology 2023Quote: DNA amplification was obtained by PCR with either KAPA HiFi HotStart ReadyMix (Roche KK2601) or Q5 High-Fidelity 2X Master Mix (New England Biosystems #M0492 ...
-
bioRxiv - Plant Biology 2024Quote: ... Real-time PCR was performed on the cDNAs using FastStart SYBR Green Master (Roche) with primers listed in Supplemental Table 3 ...
-
bioRxiv - Immunology 2024Quote: ... PCR-amplified DNA underwent standard QC (qPCR, Bioanalyzer, and KAPA Library Quantification [Roche, KK4824]) and was sequenced with unique single indexes on the Illumina NovaSeq 6000 Sequencing System using 200 bp reads.
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative PCR (qPCR) reactions were run on a LightCycler 480 (Roche-Diagnostics, Basel, Switzerland), using 2.5 μL of qPCRBIO SyGreen Blue Mix (PCR BIOSYSTEMS ...
-
bioRxiv - Neuroscience 2024Quote: ... qPCR experiments were realized on the Light Cycler 384 real-time PCR system (Roche); with SYBER green detection (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The oligo pool was PCR amplified using the KAPA HiFi HotStart ReadyMix (Roche #KK2602), 10ng of template ...
-
bioRxiv - Biochemistry 2024Quote: Homo sapiens cDNAs were amplified by PCR using KAPA HiFi DNA Polymerase (Kapa Biosystems) and sub-cloned into a variety of vector backbones ...
-
bioRxiv - Synthetic Biology 2024Quote: ... first using MASC PCR (Supplementary Data 1) in KAPA2G Fast Multiplex MasterMix (Roche, USA) and then by validating its sequence using Illumina whole genome sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative real time PCR was performed using SYBR green reagent (Kapa Biosystems Inc., USA). The quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 U of enzyme mix using the Expand Long Template PCR system (Roche). Samples were amplified with the following thermocycler conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR was carried out on a Roche Lightcycler 480 II (Roche, Basel, Switzerland) as per the standard Roche protocol with an annealing temperature of 60°C and ANOVA analysis of the 2-ΔCt values were used to determine significant differences between the control and treated samples ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR (qPCR) reactions were carried out with a LightCycler 480 System (Roche) using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: Quantitative reverse transcription PCR was performed using KAPA SYBR FAST ABI PRISM kit (Kapa Biosystems) using a QuantStudio™ 12K Flex Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Semi-quantitative PCR was performed using the Lightcycler 480 SYBR Green 2x Master (Roche #04887352001) on a Roche Lightcycler 480 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time PCR was performed on the LightCycler 480 Instument II (Roche Life Science) using LightCycler480 SYBR GREEN I master (Roche Life Science) ...
-
bioRxiv - Cell Biology 2020Quote: ... Realtime quantitative PCR reactions were performed using SYBR Green and a LightCycler 480 System (Roche). Relative expression of the target gene was normalized to Eif4a2 and Sdha expression levels ...
-
bioRxiv - Developmental Biology 2021Quote: ... The qRT-PCR was carried out using Light Cycler 480 SYBR Green I Master (Roche). MicroRNA qRT-PCR was carried out with custom designed primers to conserved miRNAs (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... All PCR reactions were done using KAPA HiFi high fidelity proof reading polymerase (KAPA Biosystems). Libraries were sequenced using NexsSeq 550 (200 bp forward read ...
-
bioRxiv - Microbiology 2019Quote: ... following the manufacturer’s instructions with final elution of templates in 40 µL PCR water (Roche) as described previously48 with some modifications to maximize RNA yield and reduce DNA contamination ...
-
bioRxiv - Developmental Biology 2020Quote: ... kit according to the manufacturer’s instructions on a LightCycler 96 Real-Time PCR System (Roche).
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by PCR amplification with KAPA 2X Hi-Fi Hotstart Readymix (Roche, Cat. No. KR0370).
-
bioRxiv - Developmental Biology 2021Quote: ... qRT-PCR was performed using the SYBR Green method according to the manufacturers’ descriptions (Roche), using the default SYBR Green program on a Roche LightCycler 480 (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... we used the Roche PCR High Purity Template Preparation Kit (Roche México, Mexico City, Mexico), following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR fragments were amplified using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche), gel extracted with Zymoclean Gel DNA Recovery kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was amplified by PCR using KAPA HIFI Hotstart polymerase (Kapa Biosystems, Wilmington, MA, USA), and 250–350 nt dsDNA was isolated on 8% native PAGE gels.
-
bioRxiv - Molecular Biology 2020Quote: All fragments were lengthened using the Expand Long Template PCR System (Roche Diagnostics, Mannheim Germany). Primers were designed using the NCBI Primer design tool and optimized to an annealing temperature of 52-54°C (Ye J ...
-
bioRxiv - Molecular Biology 2020Quote: ... The HBV DNA was amplified in a real-time PCR assay using LightCycler 480 (Roche) as previously described55 ...
-
bioRxiv - Molecular Biology 2020Quote: Quantitative PCR (qPCR) measurements were carried out on a LightCycler 480 Multiwell Plate 96 (Roche) using a DNA-binding fluorescent dye (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: Quantitative PCR (qPCR) was performed using FastStart Universal SYBR Green Master mix (Roche, Bâle, Switzerland) and an 7900HT Fast Real-Time PCR Detection System (Thermofisher ...
-
bioRxiv - Genomics 2020Quote: ... ligation products were amplified by PCR using a KAPA Library Amplification Kit (KAPA Biosystems KK2610) with 500 nM of Illumina multiplex primer (a 5′ primer that adds a P5 capture site ...
-
bioRxiv - Molecular Biology 2021Quote: ... A second round of PCR amplification was performed using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with PCR primers ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was analysed by quantitative PCR using Roche Lightcycler480 using SYBR green reagents (Roche). The following primers were designed to assess luciferase plasmid concentrations to normalise transfection efficiencies (LucChIP for;CTTGCAGTTCTTCATGCCCG ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative PCR was performed using the LightCycler® 480 Probes Master mix (Roche Applied Science) on a LightCycler® 480 (Roche Applied Science) ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time quantitative PCR was carried out using 15 µL SYBR reaction mixture (Kapa Biosystems) in a RotorGene Q cycler (Qiagen) ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was carried out with Fast Start Essential DNA Green Master Mix (Roche, 06402712001) in a Light Cycler 96 Real-Time PCR instrument (Roche) ...
-
bioRxiv - Biochemistry 2019Quote: ... The PCR products were then treated with DpnI and ligated using T4 DNA ligase (Roche), before being transformed into E ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted using a High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland). Whole genome sequencing was carried out using both Illumina MiSeq and Oxford Nanopore MinION ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng array synthesized oligos were used for PCR amplification with Kapa Hifi Polymerase (Roche) and primers Pool_ampl_f and Pool_ampl_r (Table S3) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... a combination of a branched DNA assay and an ultra-sensitive PCR assay from Roche were used to measure HIV load ...
-
bioRxiv - Cancer Biology 2019Quote: ... qRT-PCR experiments were performed using Light Cycler 480 Syber Green I Master Mix (Roche) for cDNA amplification and the qRT-PCR was carried out in a LightCycler 480 II (Roche ...
-
bioRxiv - Genomics 2021Quote: ... The ligated products were enriched with 8-10 cycles of PCR (HiFi premix, KAPA biosystems) and size selected to 200-500 bp with AMPure XP beads (Agencourt) ...