Labshake search
Citations for Roche :
1 - 50 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and 8 to 10 PCR cycles with the KAPA HiFi PCR kit (Kapa Biosystems) were used for amplification ...
-
bioRxiv - Microbiology 2024Quote: ... 300mM NaCl in dH2O) supplemented with 1X cOmplete™ EDTA-free protease inhibitor cocktail (Roche # 11873580001), 1mM Na3VO4 and 1mM NaF for 1 h at 4°C with rotation ...
-
bioRxiv - Microbiology 2024Quote: ... 300mM NaCl in dH2O) supplemented with 1X cOmplete™ EDTA-free protease inhibitor cocktail (Roche # 11873580001), 1mM Na3VO4 and 1mM NaF for 1 h at 4°C with rotation ...
-
bioRxiv - Microbiology 2024Quote: ... Fast SYBR Green Master Mix (Roche, cat# 4913850001) was used ...
-
bioRxiv - Microbiology 2024Quote: ... which were then blotted onto positively charged nylon membranes (Roche, Germany). The RNA bands were fixed to the filter by UV-crosslinking for 2 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... a chemiluminescent substrate for alkaline phosphatase detection (Roche Diagnostics).
-
bioRxiv - Microbiology 2024Quote: ... samples were collected and plasma HIV RNA levels tested by quantitative rRT-PCR (Roche Cobas Ampliprep/Cobas Taqman HIV-1 test, Roche Diagnostics, Mannheim, Germany) at the NICD.
-
bioRxiv - Microbiology 2024Quote: ... Total nucleic acids were extracted from 200 µl of each sample using the DNA/Viral NA Small Volume v2.0 extraction kit (Roche Diagnostics, Mannheim, Germany) and an automated extractor MagNA Pure 96 ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was performed on LightCycler 480 (Roche) in 384-well plates using SYBR Select Master Mix from Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... Samples were treated with TUNEL staining reagent as prepared by manufacturer’s instructions (Roche in situ cell death kit ...
-
bioRxiv - Immunology 2024Quote: ... and 125 U/mL collagenase D (Roche) using an orbital shaker at 37℃ ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Immunology 2024Quote: ... 20 mM PMSF) containing protease inhibitor cocktail (Roche). Whole cells were incubated on ice for 20 min and collected by centrifugation at 17,000g for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... plasmids were transfected into HeLa cells using X-tremeGENE HP DNA transfection reagent (Roche, Laval, QC) according to manufacturer’s protocols.
-
bioRxiv - Microbiology 2024Quote: ... RNA-seq libraries were prepared using the KAPA RNA stranded Kit (Roche-Nimblegen), and their quality and quantity were assessed with a BioAnalyzer using the High Sensitivity DNA Kit (Agilent) ...
-
bioRxiv - Microbiology 2024Quote: ... scraped into 100 μl of PBS containing protease inhibitors (Roche, Laval, QC), then transferred to a microcentrifuge tube containing 50 μl of 3X SDS-PAGE loading buffer ...
-
bioRxiv - Microbiology 2024Quote: ... one tablet complete EDTA-free protease inhibitor cocktail (Roche) per L ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proliferation rate in vitro was assessed using an xCELLigence Real-Time Cell Analyzer (RTCA) system (Roche Diagnostics)49 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protease Inhibitor Cocktail (Roche Diagnostics), 1 mM β-glycerophosphate ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pooled library was quantified using KAPA library quantification kit (Roche KK4824) and equimolar libraries were pooled and subjected to 75-bp paired-end sequencing on a NextSeq 550 machine (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The size and concentration of each sample’s library were determined using Agilent 2200 Tapestation and KAPA library quantification kit (Roche, #KK4824) respectively ...
-
bioRxiv - Cancer Biology 2024Quote: Cell viability was assessed using the MTT cell proliferation kit I (Roche), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... on an LC-480 Real-Time PCR system (Roche). Amounts of target mRNA were normalized to an endogenous housekeeping gene (γ-actin ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time RT-PCR was carried out using Real-Time PCR Master Mix (KAPA Biosystems) and following probes and primers on a 7300 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total volume of 20 μl reaction mix contained 10 μl LightCycler® 480 SYBR Green I Master Mix (Roche), 2 μl 2.5 mM primer (F+R) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was evaluated using the XTT Cell Proliferation Assay Kit II (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gene expression was detected using the LightCycler 480 SYBR Green I Master Mix or Probes Master Mix kit (Roche Diagnostics) after PCR (5 min at 95 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were washed with PBS and lysed in radioimmunoprecipitation assay (RIPA) buffer supplemented with protease (SERVA) and phosphatase inhibitors (Roche). The protein concentration was determined using a Bicinchoninic Acid Protein (BCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... resuspended in lysis buffer (20 mM HEPES, 500 mM NaCl and 10 mM imidazole, pH 7.5) with cOmplete protease inhibitor Cocktail (Roche), and lysed by a sonicator (Q125 ...
-
bioRxiv - Cancer Biology 2024Quote: ... buffer supplemented with 0.7% CHAPS (Thermo #28299) and 0.2U/μl RNase inhibitor (Roche #3335399001). Hepatocytes were lysed on ice for 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Fluorescin (Roche #11684795910) was used to detect double stranded DNA breaks according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were developed using enhanced chemiluminescence (Lumi Light or Lumi Light-plus, Roche/Sigma-Aldrich, St. Louis, MO) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... which includes a protease inhibitor cocktail (05892791001, Roche/Sigma-Aldrich, St. Louis, MO). Proteins were quantified by the protein quantification assay (BioRad ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in RIPA buffer (CST-9806) containing proteinase inhibitors (Roche) and quantified using the Pierce BCA Protein Assay Kit (Thermo-Fisher#23225) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... an enzymatic cocktail of collagenase A (1mg/mL; Roche) and Dispase II (2mg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Triton X-100) with protease and phosphatase inhibitors (Roche). Protein concentrations were measured using the DC Protein Assay Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and specific primers on the LightCycler 96 (Roche). Relative target gene expression was determined by comparing average threshold cycles (CT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and phosphatase inhibitors (#4906837001, Roche). 15-25μg of proteins were run on NuPage 4-12% gradient Bis-Tris gels in NuPAGE™ MES SDS Running Buffer (20X ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% glycerol + Complete protease inhibitor cocktail (Roche), phosphatase inhibitor (Sigma)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with 1 µg of shRNA/cDNA and 1 µg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 µl of Xtreme Gene 9 transfection reagent (Roche). After 24 hours of transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... PDOs were pooled from 6 wells and incubated for 1.5 hours on ice in Cell Recovery Buffer supplemented with phosphatase inhibitors (Roche, 4906845001). PDOs were lysed using RIPA buffer (Boston BioProducts ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RT-PCR was conducted on a LightCycler 480 Instrument II (Roche). Primer pairs for each target gene were meticulously designed and evaluated to ensure specificity and efficiency ...
-
bioRxiv - Cancer Biology 2024Quote: ... using X-tremeGENE HP DNA transfection reagent (6366546001, Sigma-Aldrich/Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Staining reaction was performed using BMP-Purple (Roche). Zebrafish larvae xenografts were photographed using a Zeiss SteREO Discovery.V8 coupled to a Zeiss AxioCam Icc 3 Camera.
-
bioRxiv - Cancer Biology 2024Quote: ... If stained with phalloidin (1/500, Scientific Laboratory Supplies P1951) and DAPI (1/1000 in PBS from 1 mg/ml stocks, Roche 10236276001), or just DAPI ...
-
bioRxiv - Cancer Biology 2024Quote: Total proteins were extracted from cultured NB cells using RIPA buffer supplemented with protease and phosphatase inhibitor cocktail (Roche). The cell lysates were pre-cleared with protein A or protein G beads (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2024Quote: Tissue or cells were washed with cold PBS and lysed in RIPA buffer containing a protease and phosphatase inhibitor cocktail (Roche Diagnostics, Indianapolis, IN, USA). Proteins were analyzed by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.1% SDS) supplemented with CompleteTM protease inhibitor cocktail (Roche, Switzerland). The extracted protein lysates were denatured with 4X SDS sample buffer (200mM Tris-HCl pH 6.8 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.075% NP-40) supplemented with 1 Complete EDTA-free protease inhibitor cocktail (Roche), 20 mM beta-glycerophosphate ...