Labshake search
Citations for Lucigen :
1 - 50 of 2345 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Single cell–derived clonal cell lines were analyzed and genotyped by PCR using genomic DNA isolated with QuickExtract DNA Extraction Solution (Lucigen) and primers binding within and downstream the modified region (Primer 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... we pooled all mice into the same tube containing a hypertonic lysis buffer (10mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 0.1% Igepal, 0.2 U/μl Lucigen NxGen Rnase inhibitor). Nuclei were extracted using a glass dounce homogenizer (DWK ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genomic DNA from 5,000 - 50,000 CAR-expressing T cells was extracted using Quick Extract (Lucigen) and used as the template for a 2-step PCR strategy ...
-
bioRxiv - Microbiology 2024Quote: ... Between 200- 500 ng of enriched mRNA was used for cDNA production using the ScriptSeq®v2RNA-Seq Library Preparation Kit (Epicentre, Madison, WI, USA), FailSafe®PCR Enzyme Mix (Epicentre ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe®PCR Enzyme Mix (Epicentre, Madison, WI, USA) and ScriptSeq®Index PCR Primers (Epicentre ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS encoding FLVA (residues 55-723) was cloned into pETite® C-His Kan Vector (Lucigen) downstream of a sequence for a Strep-tag II (WSHPQFEK ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (Lucigen).
-
bioRxiv - Synthetic Biology 2024Quote: ... coli (E cloni, Lucigen) for secondary screening ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were centrifuged and resuspended in TE buffer and incubated overnight at 37°C after addition of the Ready-Lyse lysozyme solution (Lucigen, Middleton, WI, USA). gDNA extraction (Lucigen ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA extraction (Lucigen, Middleton, WI) was performed according to manufacturer’s instructions and gDNA content was quantified using a nanodrop (Thermo-Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by incubation with Terminator 5′-Phosphate-Dependent Exonuclease (TEX) (Lucigen) to remove all residual RNAs containing 5’ monophosphate ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was subjected to ribosomal RNA depletion using the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... after ribodepletion with the Ribo-Zero Magnetic Kit for yeast (Epicentre) and sequenced on an Illumina HiSeq 4000 instrument.
-
bioRxiv - Microbiology 2024Quote: ... and ScriptSeq®Index PCR Primers (Epicentre, Madison, WI, USA) for amplification and barcoding of di-tagged cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... rRNA depletion was accomplished with the Ribo-Zero rRNA Removal Kit (Epicentre, Madison WI) and RNA purity and concentration were confirmed using a Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Biochemistry 2024Quote: The mRNA coding for the catalytic mutant AGOs used in the equilibrium binding assay was transcribed in vitro using the AmpliScribe T7 High Yield Transcription Kit (Lucigen), employing the corresponding pBYL-3×FLAG-SUMO-catalytic mutant AGO plasmids linearized with Not I as templates ...
-
bioRxiv - Molecular Biology 2024Quote: ... C-circle and G-circles assays were performed as before except that NxGen phi29 DNA Polymerase (Lucigen Corp.) were used for rolling circle amplifications [25].
-
bioRxiv - Molecular Biology 2024Quote: ... 20 U NxGen RNase Inhibitor (Lucigen), and 40 U Superscript IV RT (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was collected using QuickExtract (Epicentre). Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline) ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated from puromycin-resistant clones using QuickExtract DNA extraction solution (Lucigen), PCR amplified and tested on agarose gel for accurate deletion.
-
bioRxiv - Systems Biology 2024Quote: ... The reaction was performed overnight at 37℃ using 1x Ampligase ligase buffer (Lucigen, A1905B), 50 mM KCl (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... Genomic DNA was extracted using MasterPure yeast DNA purification kit (Lucigen MPY80200). A DNA fragment containing a gRNA with the tracrRNA scaffold sequence ...
-
bioRxiv - Bioengineering 2024Quote: ... with final resuspension into 30 µl of Quick Extract™ reagent (Lucigen). For mutagenesis analysis ...
-
bioRxiv - Physiology 2024Quote: ... RNase inhibitor (30281, Lucigen), Maxima H-RTase (EP0751 ...
-
bioRxiv - Physiology 2024Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed ATG F (TGGAATCTTCTGAACAGGTGGA ...
-
bioRxiv - Microbiology 2024Quote: ... and approximately 80 µg of RNA in 1 mL volume was digested with 5 U of RNase I (Lucigen Cat#E0067-10D1) for 45 min at 25°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the recovered cDNA was circularized by incubation in a reaction volume of 10 μl in the presence of 50 U CircLigase™ ssDNA Ligase (Epicentre), 1 M betaine ...
-
bioRxiv - Microbiology 2024Quote: ... 2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Klenow DNA Polymerase (KP810250, Epicentre, Madison, Wisconsin), and T4 Polynucleotide Kinase (EK0031 ...
-
bioRxiv - Microbiology 2024Quote: ... RNA clean-up and library prep were performed using either the Ribo-Zero(TM) rRNA Removal Kit (Epicentre) with the Illumina Truseq Stranded RNA LT kit (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNase I-treated and poly(A)-selected RNA was subjected to treatment with Terminator 5ʹ-Phosphate-Dependent Exonuclease (Epicentre; TER51020) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... v.2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions and quantified with the Qubit 4 fluorometer and the dsDNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... and gDNA was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) for PCR screening of targeting vector integration ...
-
bioRxiv - Molecular Biology 2024Quote: ... the ribosomal RNA (rRNA) was removed using the Epicentre Ribo-zero® rRNA Removal Kit (Epicentre, Road Madison, WI). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: Total 500 ng of non-purified circRNAs were used for RNase R treatment (Lucigen, Cat # RNR07250). The reaction was performed at 37° C for 30 min with 1 x RNase R buffer and 1 µL (“+” ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1.5× ampligase buffer (Lucigen). The initial denaturation at 94°C for 5 minutes was followed by ramping down to 60°C (−0.1°C/s ...
-
bioRxiv - Molecular Biology 2024Quote: Step 2 - extension & ligation: 10 μl of pre-heated (60°C) extension/ligation mix containing 5U of ampligase (Lucigen), 4U of Phusion HF DNA polymerase (#F530S ...
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA (rRNA) was depleted (Ribo-ZeroTM Gold Kit, Epicentre), cDNA libraries were built with TrueSeq total RNA sample kit (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: DNA was extracted from phNPCs with the QuickExtract DNA Extraction Solution (Lucigen). DNA lysate was used as genotyping PCR template with Q5 Hot Start High-Fidelity 2X Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli (Lucigen) and grown overnight in 500 ml LB media for 16 h at 32°C ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA was isolated from ear biopsy samples utilizing QuickExtractTM DNA Extraction Solution (Epicentre, QE09050). The tissue was incubated in 20µl QuickExtractTM at 65°C for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA was extracted from flash frozen pellets using 30 μl of QuickExtract (Lucigen # QE09050) and samples were heated to 60 °C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and FailSafe™ Buffer J (Epicentre) and resolved on a 1% agarose TBE gel.
-
bioRxiv - Microbiology 2024Quote: ... and ligated into a pHEN2 vector modified with a triple c-Myc tag108 which was used to transform electrocompetent TG1 cells (Lucigen). The resulting Nb-library consisted of 5×107 independent colonies ...
-
bioRxiv - Molecular Biology 2024Quote: ... Poly(A) Polymerase Tailing Kit (Lucigen, UK), Direct RNA Sequencing Kit SQK-RNA002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reverse-transcribed products were then gel-purified and circularized using CircLigase ssDNA Ligase (Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR genotyping was performed using the EconoTaq Plus Green 2X Master Mix (Lucigen) and primer pairs for wild-type and Chd4 floxed alleles (Table 1) ...
-
bioRxiv - Neuroscience 2024Quote: ... the pGEMHE plasmids carrying different KCR1 variants were linearized by NheI digestion and used for in vitro transcription of complementary RNA (cRNA) using the AmpliCap-Max T7 high-yield message maker kit (Epicentre Biotechnologies). For all the KCR1 expression variants ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 U/ml Baseline-ZERO DNase (Lucigen #DB0715K), 100 U/ml RNasin (Promega #N2611) ...