Labshake search
Citations for Thermo Fisher :
4751 - 4800 of 10000+ citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPROPANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and AF647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:250, A15452, Thermo Fisher).
-
bioRxiv - Microbiology 2023Quote: ... 1-2 ug of RNA was converted to cDNA using reverse transcriptase (Applied Biosystems).
-
bioRxiv - Immunology 2023Quote: ... Luc-Screen™ Extended-Glow Luciferase buffers 1 and 2 (ThermoFisher, Cat No. T1035) used according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-2 drops of ProLong Gold Antifade Mountant (cat# P36930, Molecular Probes, Eugene, OR) were added ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:1000 dilution in 2× SSC (diluted from 20× SSC, Invitrogen, 15557-044) for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... After blocking for 1 hour in 2% bovine serum albumin (BSA; BP9701, Fisher Scientific) in PBS ...
-
bioRxiv - Immunology 2023Quote: The Caco-2/THP-1 co-cultures were washed thrice with DPBS (Gibco, #10010023) to remove any residual substances ...
-
bioRxiv - Developmental Biology 2023Quote: ... The LSC growth medium contains 2:1 Dulbecco’s Modified Eagle Medium (Life Technologies, 21969035) and F12 (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... filtered through a slow filter paper (#293; 1–2 µm Sartorius, Thermo Fisher Scientific), and then used to determine electrical conductivity (EC) ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Immunology 2023Quote: ... Lymphocytes were plated at 1-2 × 106 cells/mL in RPMI: RPMI 1640 (Gibco) supplemented with 15% FCS ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM TCEP (tris(2-carboxyethyl)phosphine (TCEP) and EDTA-free protease inhibitors (ThermoFisher). Cells were lysed by sonication and the cell debris pelleted at 50000 x g and 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µL 1 M DTT and 27.5 µL of T4 Polynucleotide Kinase (Thermo Scientific) were added to the annealed oligonucleotides and the reaction was incubated for 2 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The microwells were in lysis buffer (1% 2-mercaptoethanol (Fisher Scientific, cat# BP176-100), 99% Buffer TCL (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... viruses were mixed 1:2 with PBS-washed sheep blood (Fisher Scientific, MA, USA) supplemented with 5 mM ATP ...
-
bioRxiv - Physiology 2023Quote: Isolated cardiomyocytes were loaded with 1 μM Fura-2 AM (Invitrogen, Carlsbad, California, USA) at room temperature for 15 min and then washed for 15 additional min with an external Ringer solution containing (in mmol/L) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% of Horse Serum and 1% of penicillin-streptomycin (Thermo Fisher, Waltham MA, USA).
-
bioRxiv - Biochemistry 2023Quote: ... and 1% SDS buffer and digested with 2 µL RNAse Cocktail (Thermo Fisher, AM2286) for 4 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC-1 and MIA PaCa-2 cell lines were cultured in DMEM medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... freshly diluted 1:500 in imaging media (Leibovitz’s L-15 [Gibco] with 2% FBS). 1 mL of differentiated HL-60 cells were spun down at 200x g for 3 min and resuspended in 500 µL of the labeling solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... Alexa Fluor 647 rat anti-intercellular adhesion molecule 2 (ICAM2, 1:500, A15452, ThermoFisher), rat anti-MKI67 (KI67 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and ERCC RNA ExFold RNA Spike-In Mix 1 and 2 (Thermo Fisher Scientific) were added to wild-type and Meioc-null samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then incubated in 1 mL crosslinking solution containing 2% formaldehyde (Pierce, ThermoFisher Scientific) (50mM HEPES Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caki-1 and Caki-2 cells were cultured in McCoy’s 5A modified medium (Gibco) supplemented with 10% FBS and 1% P/S ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were cultured with the 2:1 mixture of IMDM (Life technologies) and Ham’s-F12 nutrient mixture (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... Primary antibodies include Anti-beta tubulin (1:500, mouse monoclonal, 2 28 33, Invitrogen) and Anti-Hec1 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HET(1) and HET(2) hESCs was extracted using mirVana microRNA isolation kit (ThermoFisher). Small RNA libraries were generated using NEXTFlex Small RNA Library Prep Kit v3 (Cat #NOVA-5132–06 ...
-
bioRxiv - Biochemistry 2024Quote: ... containing 2% sodium dodecyl sulfate and 1 mM PMSF protease inhibitor (Thermo Fisher Scientific). Following a 30-minute incubation on ice with periodic vortexing ...
-
bioRxiv - Immunology 2020Quote: ... 4°C) and viable cells were stained using Live/dead fixable yellow stain (1:1000 in 1% FBS/PBS, Molecular Probes, 15 min., on ice). Cells were washed and incubated (15-20 min. ...
-
bioRxiv - Cell Biology 2020Quote: ... MuSCs were stained for 3 hours with 1:500 donkey anti-rabbit Alexa 594 secondary antibody (Invitrogen) to detect cleaved caspase-3 ...
-
bioRxiv - Genomics 2020Quote: ... and incubated for 1 hour in 50 µl DNAse reaction with 3 µl Turbo DNAse (ThermoFisher, AM2238) and 1X Turbo DNAse buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % of homogenate was added to 1 mL of TRIzol Reagent (Fisher Scientific cat# 15-596-026) and RNA was isolated following the user guide referenced above ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were washed in PBS (3×10 min) and incubated with Cy5 streptavidin (1:500, Life Technologies) in PBS (1 h at room temperature) ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were used between passage 1-3 Cells were enzymatically dissociated using TrypLE (ThermoFisher Scientific, MA, USA) for 5-7 minutes and centrifuged at 250G for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: The viability of the cells was examined by staining with 1 µM TOTO-3 iodide (Molecular Probes), which only stains dead cells (Zuliani et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse ENKD1 shRNA (nucleotides targeting 403-423 bp, 5′-CGCTCACCCAAGTATGACAAT-3′) were cloned into pLKO.1 (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... washed 3 times with PBS and the cellular nuclei stained with 1:1,000 of Hoechst (ThermoFisher, USA) for 15 min at RT.
-
bioRxiv - Bioengineering 2021Quote: Membrane integrity was assessed after 1 and 3 days of culture using the Live/Dead assay (ThermoFisher). We used membrane integrity as a measure of cell viability in these studies ...
-
bioRxiv - Bioengineering 2022Quote: ... Permethylated samples were combined in 1:3 ratio with 10 mg/mL 3,4-diaminobenzophenone (DABP, Acros Organics) matrix in 75% acetonitrile ...
-
bioRxiv - Microbiology 2021Quote: ... media collected from infected cells and were mixed 1:3 (v/v) with TRIzol Reagent (ThermoFisher scientific) followed by chloroform extraction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The membrane was washed for 3 times and incubated with secondary antibodies (1:5000, Thermo Fisher Scientific) for 2 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... NaCl 10 mM, MgCl2 3 mM, Tween-20 0,1%, Nonidet P40 Substitute 0.1%, Digitonin 0.01%, BSA 1%, Invitrogen™ RNAseout™ recombinant ribonuclease inhibitor 0.04 U/μL) ...
-
bioRxiv - Immunology 2020Quote: ... 105 hCD3+ T cells were mixed with human T-Activator CD3/CD28 Dynabeads (Thermofisher, ratio 3:1) or PHA (1μg/mL ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 × 105 EPCs were incubated with 1 µM LXW7-biotin in a binding buffer (1X HEPES (Gibco) containing 10% FBS (HyClone ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... Wells were washed 3 times and incubated with 1 μg/ml biotinylated anti-human IgE (A18803, Invitrogen) in 1% skim milk for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were washed 3 times with PBS and an aliquot of 1 ml of warmed TrypLE (Gibco) added to each well and incubated at 37°C for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM EDTA) for 3 hours at room temperature using Slide-a-Lyzer mini dialysis cups (ThermoFisher), diluted to 100 μM ...
-
bioRxiv - Immunology 2021Quote: ... with confluent bEnd.3 cell monolayers or pre-coated with collagen I (1 mg/ml, Life Technologies), and allowed to adhere for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were washed 3 × 10 min in TBS-T and secondary antibody incubation (1:750; Life Technologies) was performed for 1 hr ...
-
bioRxiv - Neuroscience 2022Quote: ... HLA-DR Antibody (Monoclonal Rabbit Anti-Human, Citrate Buffer HIER, dilution 1:50 Clone: LN-3, Invitrogen, Thermo Fisher Scientific ...