Labshake search
Citations for Thermo Fisher :
4651 - 4700 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Fc-PRL-13 was purified with Protein A agarose resin (Thermo Fisher Scientific; 20334) according to the manufacturer’s instructions with the exception that all buffers were supplemented with 1tab/50mL of cOmplete Protease Inhibitor Cocktail and 10uM Pepstatin A ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with 10% (v/v) heat-inactivated FCS (Invitrogen, 10270-106, batch number 41F8126K), 2,000 units ml−1 LIF (Millipore ...
-
bioRxiv - Cell Biology 2023Quote: Human JAGGED1-Fc (Martin et al., 2023) was transfected into Expi293F cells (ThermoFisher, A14527) using FectroPro (Polyplus ...
-
bioRxiv - Synthetic Biology 2023Quote: ... according to the manufacturer’s instructions using a Multiskan™ FC microplate photometer (Thermo Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... Detection was performed with secondary goat anti-mouse IgG Fc HRP antibody (Invitrogen, A16084) and WesternBright Sirius chemiluminescent HRP conjugate (advansta ...
-
bioRxiv - Neuroscience 2023Quote: ... single cell suspensions were incubated with Fc Block CD16/32 (Invitrogen; 14-0161-85). The cells were then incubated for 30 minutes with the surface antibodies and Live/Dead Ghost Dye Violet 510 (Tonbow Biosciences ...
-
bioRxiv - Bioengineering 2023Quote: ... supplemented with 10% (v/v) fetal calf serum (FCS, Gibco Cell Culture, 10270-106), 0.5% (v/v ...
-
bioRxiv - Immunology 2022Quote: Single cell suspensions were incubated with Fc Block CD16/32 (Invitrogen, 14-0161-85). The cells were then incubated with a 1:200 dilution of antibody for surface stains and A Live/Dead Ghost Dye Violet 510 (Tonbo Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved at −150°C in 40% heat-inactivated fetal bovine serum (FCS, Gibco), 50% RPMI-1640 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with anti-CD16/CD32 (diluted 1:50, Thermo Fisher Scientific) and cells were stained with cell surface antigens ...
-
bioRxiv - Cell Biology 2023Quote: ... After Fc receptor blockage using an antibody for CD16/32 (14-0161-85, Invitrogen), stainings were performed in FACS buffer (1 % BSA ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10 % fetal calf serum (FCS, Gibco, ThermoFisher Scientific, Hanover Park, IL, USA). In order to induce the Tripz-construct cells were treated with a final concentration of 5 µg/ml doxycycline hyclate (DOX) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and Fc fusions were purified with Protein A agarose resin (Thermo Fisher Scientific; 20334) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Fc glycans were released and labelled using the GlycanAssure ATPS kit (Thermo Fisher Scientific) then separated using 3500xL Genetic Analyzer (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... HI samples were incubated with 1 mL of IgG Fc Capture Select (Thermo Fisher) resin at 4C for 20 to 48 h to bind IgG ...
-
bioRxiv - Bioengineering 2024Quote: ... Siglec-Fc constructs were expressed according to the Expi293F manufacturer protocol (Thermo Fisher Scientific) and purified by manual gravity column (BioRad ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 10% fetal calf serum (FCS, Biowaste) and 1% penicillin/streptomycin (Gibco, 15140).
-
bioRxiv - Molecular Biology 2021Quote: For absolute quantification of viral miRNAs in comparison for viral genome 1:1000 dilution of ERCC RNA Spike-In Mix (ERCC-130 12 amoles) (Invitrogen, 4456740) and a custom sRNA oligo (GAGAGCAGUGGCUGGUUGAGAUUUAAU ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 500 ng of RNA was used to prepare libraries and spiked-in with ERCC Exfold Spike-in mixes (Thermo Fisher 4456739). The TruSeq Stranded mRNA Library Preparation kit (Illumina 20020594 ...
-
bioRxiv - Immunology 2022Quote: ... the DNA fragments encoding the spikes of the sarbecoviruses without the ER retrieval signal were codon-optimized and synthesized at GeneArt (Life Technologies). The spike encoding genes of Pang17 (residues 1-1249 ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 HexaPro Spike protein for cryoEM analysis was produced in HEK293F cells grown in suspension using FreeStyle 293 expression medium (Life Technologies) at 37°C in a humidified 8% CO2 incubator rotating at 130 r.p.m ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Molecular Biology 2020Quote: ... An aliquot of 500 ng of total RNA was spiked with external controls ERCC RNA spike-in Mix (Thermo Scientific, 4456740) and libraries constructed with the TruSeq Stranded mRNA sample preparation kit (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... supplemented with 1 μl of the 1:105 diluted ERCC spike-in mix and 1 μl (50 μM) of random hexamer primer (ThermoFisher 3005) for first strand cDNA synthesis ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Plant Biology 2019Quote: ... The 5-EU labeled aadA spike-in was transcribed in vitro from the PCR product using the T7 RNA Polymerase (Thermo Scientific). Labeling and purification were carried out as for the LUC RNA.
-
bioRxiv - Microbiology 2021Quote: Concentrated samples of OV-Q1 and OV-spike were mixed with NuPAGE™ Sample Reducing Agent (Cat. # NP0008, Thermo Fisher Scientific). The samples were heated at 70°C for 10 min utes and then loaded on 15% SDS-PAGE gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... The integrity of each sample was checked by loading 5 μL of total RNA alongside a spike-in control (P4P62HP, 50 ng) onto a PAGE-Urea-TBE gel and visualized by SYBR Gold (Thermo Fisher). Subsequently ...
-
bioRxiv - Immunology 2021Quote: ... A CMV promoter/enhancer with an SV40 polyA was introduced into the E1 region and the spike gBlock sequences introduced by Gibson assembly (Codexis) and transformed into Stbl4 (Thermo Fisher) cells ...
-
bioRxiv - Immunology 2020Quote: ... RNA-Seq libraries were prepared from 65 ng of total RNA with ERCC ExFold RNA Spike-In Mix 1 (Life Technologies) of 1 μL of 1:5000 (v/v ...
-
bioRxiv - Genomics 2022Quote: ... was used to enrich poly(A) mRNA from 500 ng total RNA with 5 µL 1:500 diluted ERCC RNA Spike-In control mix (Thermo Fisher) in 50 µL ...
-
bioRxiv - Microbiology 2022Quote: ... The CHO cell growth and Spike recombinant plasmid transfection were performed according to the ExpiCHO expression system User Guide (MAN0014337, ThermoFisher website). The S-trimer expression was under the control of a strong CMV promoter ...
-
bioRxiv - Developmental Biology 2023Quote: RNA extracted from equal number of ESCs was spiked with synthetic RNAs from the External RNAs Control Consortium (ERCC) Spike-in Mix1 (Thermo Fisher), by adding 2µl of 1:100 ERCC dilution to 10µl of RNA (equivalent to ∼1-2µg) ...
-
bioRxiv - Immunology 2023Quote: ... followed by C-terminal 8x His and 2x Strep tags for affinity purification.[19] The trimeric Spike protein was expressed as previously reported.[71–73] transiently expressed in suspension-adapted ExpiCHO cells (Thermo Fisher) in ProCHO5 medium (Lonza ...
-
bioRxiv - Biochemistry 2023Quote: Recombinant trimeric spike proteins (5 µg/mL) were plated in 50 µl in each well on a MaxiSorp (Thermo Fisher Scientific) microtiter plate in 1xPBS and left to incubate for at least 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... a C-terminal T4 foldon fusion domain to stabilize the trimer complex followed by C-terminal 8x His and 2x Strep tags for affinity purification.5 The trimeric Spike protein was transiently expressed in 200 mL of suspension-adapted ExpiCHO cells (Thermo Fisher) in ProCHO5 medium (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... The Spike region of VSV-S virions was amplified via the SuperScriptTM IV One-Step RT-PCR System (Thermo Fisher Scientific) and purified using the SPRIselect - PCR Purification and Cleanup Kit (Beckman Coulter Life Sciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was harvested from an equal number of cells 72 hours post reverse-transfection and spiked with an exogenous ERCC spike-in (Thermo Fisher). Non-stranded Poly-A libraries were constructed and sequenced with 150 base pair sequencing at 40 million reads on the DNB-seq DNA sequencing platform ...
-
bioRxiv - Molecular Biology 2023Quote: ... with each library’s input consisting of 9μL 100ng/μL total RNA (900 ng) mixed with 1μL of a 1:250 dilution of ERCC RNA spike-in controls (Thermo Fisher 4456740). RNA fragmentation was performed at 94°C for 6min ...
-
bioRxiv - Cancer Biology 2021Quote: ... A region spanning 2163 bps upstream from the transcription start site was PCR amplified using genomic DNA isolated from HEK293 cells with Platinum SuperFi II DNA polymerase (Thermo Fisher Scientific). The PCR product was cloned into pGL3 basic vector following conventional protocols ...
-
bioRxiv - Cell Biology 2020Quote: Samples prepared following immunoprecipitation from HEK293 MceC3XFLAG cell line were analysed by LC-MS on an Orbitrap Elite™ mass spectrometer (ThermoFisher Scientific) coupled to a Dionex Ultimate 3000 Ultra-Performance Liquid Chromatography (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 Phoenix cells were transfected with the pBabe plasmid DNA encoding for the protein of interest using Lipofectamine 3000 (Thermo Fisher Scientific) per manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Transfection of Flp-In T-Rex HEK293 cells was carried out according to Flp-In™ T-REx™ Core Kit (Invitrogen). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pcDNA3.1-GAS6-MycHis linearized with PvuI restriction enzyme using Lipofectamine® 2000 Transfection Reagent (Thermo Fisher Scientific), according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA5-based constructs for the expression of C-terminally His6-PreScission protease cleavage site-2xFlag (Flag)-tagged full-length or N-terminally truncated ASCC3 variants were transfected into HEK293 Flp-In™ T-REx™ cells (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... For the preparation of the BGLF2-KO virus, HEK293/EBV(dBGLF2) cells (Konishi et al., 2018) were transfected with BZLF1 expression plasmid using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Linearized plasmids containing the ItypOrco gene were transfected into HEK293 cells containing a tetracycline-inducible repressor (TREx) using Lipofectamine 2000 (Thermo Fisher Scientific) (Corcoran et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293-EBV B(+/−) S13+/− cells were transfected with pCDNA3-BZLF1 and pCDNA3-BALF4 using TurboFect Transfection Reagent (Thermo Scientific, Waltham, MA, USA). Old medium was changed with fresh medium in one day post transfection ...
-
bioRxiv - Immunology 2021Quote: HEK293 adherent cells grown to a confluency of 70–90% were transfected using a Lipofectamine 3000 Reagent Kit (L3000075, Invitrogen, Waltham, MA). Transfection procedures were adapted from the product manual ...