Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 1859 citations for N Acetyl Tizanidine d4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... All data were normalized to the total protein content determined in protein pellets after neutralization with 10 N NaOH and sonication in 2% SDS plus 8 mM EDTA using a bicinchoninic acid assay (ThermoFisher Scientific) and bovine serum albumin as a standard.
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transiently co-transfected with 100 ng in total of an N- or C-terminal LgBiT and SmBiT tagged construct using Lipofectamine™ 3000 Transfection Reagent (ThermoFisher). All possible combinations of the N-terminal and C-terminal-tagged split luciferase protein pairs were tested ...
-
bioRxiv - Neuroscience 2021Quote: Flash frozen samples (n=3 per genotype) were prepared for Western blot using the Mem-PER Plus protein extraction kit (89842, Thermo Scientific) to isolate membrane and cytoplasmic protein fractions from mice aged P29-32 ...
-
bioRxiv - Bioengineering 2021Quote: Ovaries from 6 to 8 day-old CBA × C57BL/6 (F1) mice were collected and transferred to Leibovitz L-15 media (P/N 11415, Gibco, USA). The ovaries were dissected into 2–4 pieces and transferred into maintenance media (α-MEM ...
-
bioRxiv - Immunology 2022Quote: ... were washed with 100 mM monobasic sodium phosphate pH 6.2 and activated by addition of Sulfo-N-Hydroxysulfosuccinimide (Thermo Fisher Scientific) and 1-Ethyl-3-(3-dimethylaminopropyl ...
-
bioRxiv - Plant Biology 2020Quote: ... and the percentage of C and N per sample was calculated with the instrument’s software (Eager Smart, Thermo Scientific, Walham, MA). Biomass and percent N values were multiplied to estimate total N in plant tissues.
-
bioRxiv - Microbiology 2019Quote: ... The viral N-protein was labeled using a primary anti-Tula virus antibody(12) and a secondary anti-rabbit FITC conjugate (Invitrogen, USA). The viral Gc protein was stained using a mouse monoclonal antibody (#H1808-60B ...
-
bioRxiv - Neuroscience 2019Quote: pLVX-EF1a-TS-EGFP-IRES-Puro was cloned by introducing an N-terminal Twin-Strep (TS)-tagged EGFP cDNA (DNA String byGeneArt, Life Technologies) into the EcoRI and BamHI sites of pLVX-EF1a-IRES-Puro (Clontech ...
-
bioRxiv - Neuroscience 2019Quote: ... pLVX-EF1a-TS-OPT-FUS-IRES-Puro was cloned by introducing an N-terminal Twin-Strep (TS)-tagged codon optimized FUS cDNA (Gene synthesis by GeneArt, Life Technologies) into the EcoRI and BamHI sites of pLVX-EF1a-IRES-Puro (Clontech ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was isolated from whole eyes of 6-month old cep290 mutant and sibling control animals (n = 9 per group) with Trizol (ThermoFisher 15596026). Reverse transcription using 1 μg RNA was performed with the iScript cDNA Synthesis kit (Bio-Rad 1708891) ...
-
bioRxiv - Genomics 2020Quote: ... 4 μM glass slide) then for Laser Capture Microdissection (LCM; N=3; 7 μM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522). The slides were stored at −20°C in an airtight container with desiccant until ready for dissection (1 day to 3 months) ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were stained at 4°C o/n in 50 µL of the 1st antibody diluent (rabbit anti-ZO-1, 61-7300, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biochemistry 2021Quote: For the first set of experiments we used the Nunc™ MicroWell™ 96-Well Microplates (ThermoFisher Scientific, cat. n. 269620) with Nunc™ Microplate Lids (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2021Quote: ... coli phosphate-binding protein labeled with 7-Diethylamino-3-[N-(2-maleimidoethyl)carbamoyl]coumarin (MDCC) (phosphate sensor, CAT # PV4406, Thermo Fisher) upon binding of the free phosphate GTP hydrolysis product (excitation at 425 nm ...
-
bioRxiv - Cancer Biology 2021Quote: 100,000 cells for SK-N-SH and IC-pPDXC-63 cell lines were plated in a 4-well Lab-Tek chamber (Cat# 177399PK, Thermo Fisher) 48 hours before immunostaining ...
-
bioRxiv - Immunology 2020Quote: Macrophages were incubated with the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (10 μM, Invitrogen, California, USA) in PBS for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: C2C12 myoblasts were transfected with a plasmid containing the N-terminal 88 amino acids of human cyclin B1 fused to EGFP using Lipofectamine 3000 (Invitrogen, L3000001) with the P3000 reagent according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and human CMP-N-acetylneuraminate-poly-α-2,8-sialyltransferase (ST8SIA4) (NP_005659)were codon-optimized for human expression and synthesized (Geneart, Thermo Fisher Scientific). A cDNA encoding a soluble version of human NCAM ...
-
bioRxiv - Cell Biology 2019Quote: Whole cell extracts of cultured cells were lysed in 1.5% n-dodesylmaltoside (Roth) in PBS supplemented with protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific) as described (Fernandez-Mosquera et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Species was confirmed by amplifying a region of mitochondrial DNA using the primers C1-J-2495 and C1-N-2800 (Wells and Sperling, 2001) and Platinum Taq DNA polymerase (Life Technologies) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... the N-terminal His-tagged protein was purified in a single step protocol using HisPur Ni-NTA resin (Thermo Fisher Scientific), equilibrated at RT ...
-
bioRxiv - Immunology 2021Quote: ... were cloned into pCEP4 mammalian expression vector containing N-terminal human Ig kappa leader sequence and C-terminal Avi-tag and His-tag (Invitrogen, USA). Expi293-Freestyle cells cultured at 37°C and 8% CO2 in growth medium containing Expi293 Expression Medium at 3×106/mL in 50 mL media were transfected overnight at 37 °C with 50μg of plasmid in 160μL of ExpiFectamine plus 6mL of OptiMEM-I (all from Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... total RNA from testicular explants (n = 20 males) was extracted by using the commercial RNAqueous®-Micro kit (Ambion, Austin, USA), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... and a 50 cm analytical column (Acclaim PepMap 100, 75 μm x 50 cm, C18, P/N ES803, Thermo Fisher Scientific). The injection volume was 2 μL out of 18 μL in which the samples were dissolved in the autosampler ...
-
bioRxiv - Cell Biology 2021Quote: ... or si-hsa-CHST15_0003 (n□=□3) or si-hsa-TNFRSF21_0001 (n□=□3) for 24□hours was carried out by using human Clariom™ Sassay (ThermoFisher Scientific) at the Bioinformatics and Expression Analysis (BEA ...
-
bioRxiv - Cell Biology 2021Quote: ... and sterols derivatized in 50 μL N,O-bis(trimethylsilyl) trifluoroacetamide with 1% trimethylchlorosilane (BSTFA + 1% TMCS, Thermo Fisher TS-38831) at 60°C for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant 6XHis-tagged TbVps24 (N-terminus tag) was cloned using the pTrcHis TOPO TA expression system (Thermo Fisher Scientific, Carlsbad, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... or mouse monoclonal anti-N-Cadherin clone GC-4 followed by AlexaFluor 647-conjugated goat anti-mouse antibody (1:200 dilution, ThermoFisher Scientific). Staining was performed for 30 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: Viral N protein was detected using a rabbit anti-SARS-CoV N antibody [32] as a primary antibody with AlexaFluor 568 anti-rabbit IgG or anti-rabbit IgG-HRP (Thermo Fisher) as secondary antibodies together with DAPI to stain the nucleus by indirect immunofluorescence as described previously [33].
-
bioRxiv - Neuroscience 2020Quote: ... The samples were double-blinded microinjected into the cytoplasm of single COS-7 cells (n=100-200 cells per sample) along with fluorescein-labeled dextran (molecular weight 10000, Life Technologies) using a micromanipulator (Narishige) ...
-
bioRxiv - Immunology 2020Quote: ... or empty vector control GFP+ cells (n=6) using TRIzol reagent according to manufacturer instructions (Thermo Fisher Scientific, Waltham, MA, USA). Integrity of total RNA was checked using Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... containing 2’-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 50 μM; Thermo Fisher Scientific). To determine FA uptake ...
-
bioRxiv - Microbiology 2021Quote: ... reverse:CCATCCAATCGGTAGTAGCG) or the SARS-CoV-2 N gene (forward: TTACAAACATTGGCCGCAAA, reverse: GCGCGACATTCCGAAGAA) and Power SYBR Green PCR Master Mix (Applied Biosystems) were used to amplify cellular RNA and viral RNA by QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: Whole-cell lysates were obtained incubating cell pellets with a Lysis Buffer (2% n-dodecyl β-dmaltoside (DDM) (Thermo Scientific, #89903) plus 1X protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... and pcDNA3.1(+)-N-HA-RTEL1-ΔHHD1+2) (Supplementary Table S3) were transfected using Lipofectamine® 2000 reagent (Invitrogen; Cat. No.11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Synthetic peptides were coupled to rabbit serum albumin (RSA) with the linker Sulfo-m-maleimidobenzoyl-N-hydroxysuccinimide ester (Sulfo-MBS, Thermo Scientific) in a carrier (1):linker (50):peptide (50 ...
-
bioRxiv - Plant Biology 2022Quote: The full-length coding sequence of the genes were cloned into pSPYNE-35SGW (N-terminal YFP) and/or pSPYCE-35SGW (C-terminal YFP) through gateway cloning (Invitrogen™). BiFC was carried out as described (Gou et al. ...
-
bioRxiv - Microbiology 2022Quote: Copies of the SARS-CoV-2 N gene (genomic) were measured by qRT-PCR TaqMan Fast Virus 1-step assay (Applied Biosystems). SARS-CoV-2 specific primers and probes from the 2019-nCoV RUO Assay kit (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 2.5 µg of the in vitro synthesized RNA was used to transfect ∼6 ×105 BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 genes [65] using the MessengerMax lipofection kit (Thermo Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were dried at 70°C for at least 20 h and the total N (% g dry weight [DW]) and 15N (atom%) contents were analyzed using a Flash2000-DELTAplus Advantage ConFlo? System (ThermoFisher Scientific) at Shoko Science Co. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... SCOs were washed o/n in 1x PBS and cryopreserved gradually in sucrose before being embedded (TissueTek OCT, Fisher Scientific, 10690461) and flash-frozen on dry-ice ...
-
bioRxiv - Neuroscience 2022Quote: ... the muscle layer of the gut was extracted using a forceps n.4 (FST, Germany, EU) and placed in Hank’s buffer solution (HBSS) (Invitrogen, Germany, EU). The tissue was then incubated in Collagenase I (Worthington ...
-
bioRxiv - Neuroscience 2022Quote: ... sympathetic ganglia were extracted using a forceps n.4 (FST, Germany, EU) and placed in Hank’s buffer solution (HBSS) (Invitrogen, Germany, EU). The tissue was then incubated in Collagenase I (Worthington ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 3.6 μg of pOG44 and 400 ng of either N- or C-terminal pDEST-pcDNA5-c17orf80-BirA*-FLAG using Lipofectamine 2000 (Invitrogen; 11668019) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and its N-terminal amino-acid sequence was analyzed by Edman microsequencing(39) on a Procise 494 cLC protein sequencer (Applied Biosystems), using the standard pulsed-liquid program for PVDF-blotted proteins.
-
bioRxiv - Neuroscience 2022Quote: HEK293T cells were grown on 10 mm glass coverslips in 24-well plates in DMEM medium (Thermo Fisher, cat n°10566016) supplemented with fetal bovine serum (10% ...
-
bioRxiv - Microbiology 2022Quote: SpRecAA488 was made by covalently modifying primary amines (lysines or N-ter) of the protein with Alexa 488-succinidimyl ester (Molecular Probes, ThermoFisher), in presence of an excess of ssDNA (M13 mp18 ...