Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were then washed 3 times for 5 minutes each in PBS before incubation with secondary goat anti-rabbit 647 (ThermoFisher Scientific, cat #A21244) and goat anti-rat 568 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Genomics 2020Quote: ... The resulting pellet was allowed to air-dry for 5 min and finally resuspended in molecular biology grade H2O for quantitation using a Qubit 3 Fluorometer (Thermo Fisher Scientific, Q32850), and the integrity of the genomic DNA was validated using Agilent 4200 TapeStation (Agilent ...
-
bioRxiv - Systems Biology 2019Quote: The 72 fractions obtained from the OG fractionation (3 TMT x 24 fractions) were loaded on a trap nanocolumn (0.01 x 2 cm, 5 μm; Thermo Fisher Scientific, Massachusetts, USA) and separated with a C-18 reversed-phase (RP ...
-
bioRxiv - Biochemistry 2021Quote: Hsc70cb cDNA was amplified using PCR and inserted into the pProEX-HTA protein expression vector using 5’ SacI and 3’ SpeI restriction enzyme sites (Invitrogen, Carlsbad, CA, USA). Two Drosophila NBD constructs (with or without a stop codon ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Pathology 2021Quote: ... or LGALS1 siRNA (Eurofins Genomics; Ebersberg, Germany) with the sense sequence 5’-[UUGCUGUUGCACACGAUG-GUGUUGG]-3’ the following day using Lipofectamine® RNAiMAX (Thermo Fisher Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted RNA from each positive sample was used as template to synthesize cDNA using primer MBTuni-12 (5’-ACG CGT GAT CAG CRA AAG CAG G-3’) and Superscript III First Strand Synthesis SuperMix (Invitrogen, Carlsbad, CA, USA), following the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 72 hours with one of two different oligos (siNF-κB 5’-ACAGUAGGAAGAUCUCAUC-3’ and sip65 5’-UUUACGUUUUCUCCUCAAUC-3’) to the p65 subunit of NF-κB at a concentration of 100 nM using Oligofectamine (Life Technologies, Benicia, CA). After transfection ...
-
bioRxiv - Molecular Biology 2022Quote: Human hPSCs cultured on MEFs were harvested using collagenase IV as big aggregates and settled 3 times in washing media (DMEM [Thermo Fisher Scientific], 5% Newborn Calf Serum [Sigma], 1X Penicillin & Streptomycin [Thermo Fisher Scientific]), then strained by an 80μm strainer ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was prepared from tissue samples (3-5 mg) or cell pellets (2.5×105 cells) using the Ambion PureLink RNA minikit (Life Technologies, Carlsbad, CA, USA) as directed by the supplier ...
-
bioRxiv - Microbiology 2022Quote: ... and Viral genomic terminal sequences were determined using commercial 5’ and 3’ RACE (rapid amplification of cDNA ends) kits (Invitrogen, Waltham, MA, USA). The PCR products were gel-purified using the Gel Extraction Kit (OMEGA Bio-Tec Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Developmental Biology 2022Quote: ... were equilibrated in 3 ml of IVC1 medium in an incubator with a humidified atmosphere of 5% CO2 at 37 °C (Thermo Scientific, Heracell 240i) for at least 12 h prior to 3E-uterus embryo culture ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed in PBS 3 times for 5 minutes and mounted with ProLong Gold Antifade Mountant (#P36930, Thermo Fisher Scientific, Waltham, MA). Histological evaluation was performed single blinded ...
-
bioRxiv - Biochemistry 2022Quote: ... Chemiluminescence was induced by incubating the membranes for 3-5 minutes in the SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific, 34580). Images were captured through a gel imager (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA fragment was labeled with 5-(3-aminoallyl)dUTP by nick translation according to the manufacturer’s protocol (Ares DNA labeling kit, Molecular Probes, Eugene, OR, USA), and the incorporated dUTPs were labeled with amino-reactive Alexa Fluor 647 dye by using the same Ares DNA labeling kit ...
-
bioRxiv - Plant Biology 2022Quote: ... the specific entry clones described above (TRB1-3, 5 in pDONR207 and TRB4 in pENTR223) were used in LR Clonase™ II (Thermo Fisher Scientific) reactions to create the pGWB6 (N-terminal GFP fusion under the 35S promoter ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.5 µl of both forward and reverse primers (5 µM) were run on the QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). The primers used in this study were ...
-
bioRxiv - Genetics 2023Quote: ... RNA was extracted in pools of 10 from 3-5 days old females randomly selected and unexposed to any insecticides using Arcturus PicoPure RNA isolation kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Both real-time PCR reactions were performed using Universal MasterMix and TaqMan MGB probes with 5’FAM and a 3’ nonfluorescent quencher (NFQ, Thermo Fisher, CA. USA). The obtained cycle threshold values were converted to an arbitrary amount by using standard curves from a serial dilution of a pooled sample made from all samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for 3 days at a density of 5 × 104 cells per well in a 96-well tissue culture plate (Thermo Fisher, Nunclon delta). The media was then replaced with fresh PMA-free media and the cells were left to rest for 24 h before the infection protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... rinsed with 0.1 M PBS (5-10 min x 3) at room temperature and then counterstained with DAPI (200 ng/ml in PBS; D1306, Life Technologies, Carlsbad, CA) at room temperature for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA was extracted from the SGs from SGs of 3-5-day-old fifth-instar larvae using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and gravitational sedimentation by washing 3 times in wash media composed of DMEM/F12 supplemented with 5% fetal bovine serum (Thermo Fisher: 10082– 147) and 1000 U/ml penicillin/streptomycin ...
-
bioRxiv - Genetics 2024Quote: ... followed by the addition of 300 ng of predesigned sgRNA targeting exon 3 region of the XPC gene with a crRNA sequence (5’AGGCACACCATCTGAAGAGA3’) (Thermofisher Scientific, Massachusetts, USA). The sgRNA and Cas9 mixture was incubated for 10 minutes at room temperature to assemble and form the ribonucleoprotein complex ...
-
bioRxiv - Immunology 2024Quote: ... Primers were designed with 3’ BamHI and 5’ KpnI sites flanking each sequence and the fragment amplified using Phusion™ High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Purified PCR product was digested with BamHI-HF and KpnI-HF (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA fragment was labeled with 5-(3-aminoallyl)dUTP by nick translation according to the manufacturer’s protocol (Ares DNA labeling kit, Molecular Probes, Eugene, OR, USA), and the incorporated dUTPs were labeled with amino-reactive Alexa Fluor 647 dye by using the same Ares DNA labeling kit.
-
bioRxiv - Cell Biology 2024Quote: ... and membranes were washed 3×5 minutes in 1X TBS-T before being developed using Pierce SuperSignal West Pico PLUS (Thermo Scientific, cat: 34580) (β-catenin ...
-
bioRxiv - Immunology 2020Quote: ... purified B cells were incubated at 6 × 106 cells ml-1 in 1 mL of PBS with 1 uL of 5 mM Cell Trace Violet (CTV) dye (Thermo Scientific). The CTV-stained B cells were washed and activated as detailed above and subjected to flow cytometry analyses 4 days after activation.
-
bioRxiv - Microbiology 2023Quote: ... Transfection was performed with 5 µg of pLKO.1 puro pri-mir-1-1 vector using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... either Alexa Fluor568- or Alexa Fluor647-conjugated antibody in 3 % BSA/PBS (Invitrogen, 1:500). Following three PBS washes ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Microbiology 2019Quote: ... membranes were blocked with 3% BSA and incubated with Streptavidin-HRP (1:4000; Thermo Scientific) in 0.3% BSA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sections were washed by PBTriton 3 times and incubated with 1:1000 phalloidin–Alexa488 (Invitrogen) and 1:4000 DAPI in PBTriton for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... AsPC-1 and BxPC-3 cells were maintained in Roswell Park Memorial Institute (RPMI, Invitrogen) supplemented with 10% FBS and 4 mM L-glutamine ...
-
bioRxiv - Cancer Biology 2021Quote: ... PerCP-eFluor 710 mouse anti-human CD223 (LAG-3) (1:100; 46-2239-41, Invitrogen), and BV421 mouse anti-human CD366 (TIM-3 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA in adult testes was stained with To-Pro-3 (1:1000, Life Technologies, T3605) solution in the dark for 15min ...
-
bioRxiv - Biochemistry 2022Quote: Cells were either transfected with PEI (1 μg/3 μg DNA) or lipofectamine 2000 (ThermoFisher) diluted in OptiMEM (Gibco ...
-
bioRxiv - Biophysics 2021Quote: ... cells were incubated for 3 min with Hoechst 33342 (Thermo Fisher Scientific, dilution 1/10,000) for live-cell nuclear fluorescence labeling.
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were counted every 1-3 days using CyQuant Direct Proliferation Assay kit (Life technologies). An inverted plate reader (Flexstation 3 ...
-
bioRxiv - Genetics 2020Quote: ... 3-Phosphoglycerate kinase (Pgk1) protein was detected with anti-Pgk1 monoclonal antibody (1:30,000; Invitrogen) and HSP90 protein was detected with a mouse anti-HSP90 monoclonal antibody (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with a 3:1 mixture of Newborn Calf Serum (NBCS) (Gibco, Thermo Fisher Scientific) and Fetal Calf Serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with a 3:1 mixture of Newborn Calf Serum (NBCS) (Gibco, Thermo Fisher Scientific) and Fetal Calf Serum (FBS ...