Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Stained for 5 mins with 1:2000 DAPI (Thermo Fisher Scientific; 62248) in PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stained for 5 mins with 1:2000 DAPI (Thermo Fisher Scientific; 62248) in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 x 5 minutes) and mounted in SlowFade Diamond (Thermo Fisher S36972). For the overnight steps ...
-
bioRxiv - Immunology 2020Quote: ... and cultured (5-10 x 105 cells ml-1) in RPMI (GIBCO) supplemented with 15% FBS (Hyclone ...
-
bioRxiv - Immunology 2022Quote: ... 5% 1M HEPES and 1% gentamicin (all Thermo Fisher Scientific, Waltham, MA). For Vero E6 cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% fetal bovine serum and 1% Glutamax (Thermo Fisher Scientific). 293T cells were cultured in DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Cy-5-coupled goat anti-rabbit (ThermoFisher A-10523; diluted 1:500), Cy-3-coupled goat anti-guinea pig (Abcam ab102370 ...
-
bioRxiv - Microbiology 2020Quote: ... 1~5 μg RNA were reverse-transcribed using RevertAid transcriptase (Thermo Scientific) and random hexamer ...
-
bioRxiv - Immunology 2020Quote: Cells were loaded with 5 μg/mL Indo-1 AM (Life Technologies) and stained with lineage markers for 15 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% fetal bovine serum (FBS) and 1 % penicillin/streptomycin (Gibco, Life Technologies,
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of FGFb Recombinant Human Protein and 1% Gluta-MaxTM (Gibco) in flasks coated with Matrigel Matrix Basement Membrane (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml blasticidin (Melford Laboratories) or 1 mg/ml G418 (Invitrogen) as appropriate.
-
bioRxiv - Microbiology 2022Quote: ... The homogenate was diluted 1/5 in Opti-MEM (Thermo Fisher Scientific) and centrifuged at 17.000g for two minutes to pellet cell debris ...
-
bioRxiv - Molecular Biology 2022Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% FBS and 1 mg/mL geneticin (Gibco #10131-035). Calu-3 2B4 (BEI Resources # NR-55340 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mL penicillin/streptomycin (1% final concentration, Thermo Fisher Scientific, 15140-122).
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mL penicillin/streptomycin (1% final concentration, Thermo Fisher Scientific, 15140-122), 5 mL L-glutamine (2mM final concentration ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mL penicillin/streptomycin (1% final concentration, Thermo Fisher Scientific, 15140-122), 5 mL L-glutamine (2mM final concentration ...
-
bioRxiv - Microbiology 2023Quote: ... 5 g l-1 low-melting agarose (Thermo Scientific, Waltham, MA, USA)) and 300 μl overnight bacterial culture ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in 1 ml of 5% trichloroacetic acid (SA433, Thermo Fisher Scientific) and incubated at 4°C for a minimum of 10 min ...
-
bioRxiv - Genomics 2023Quote: ... (5) A combination of 1 µL GlycoBlue (Cat#AM9515, Thermo Fisher Scientific), 100 μL of 3 M sodium acetate (pH 5.2) ...
-
bioRxiv - Neuroscience 2023Quote: ... and blocked in 1 % PBS-T containing 5 % normal goat serum (ThermoFisher) for 2 h ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 5% Charcoal Striped Serum (Biowest) and 1% penicillin-streptomycin (Gibco) before being transfected with the cloned ERα-focused STARR-seq capture library using polyethylenimine (Polysciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and treated with 1 mM 5-ethynyl uridine (ThermoFisher, Catalog No. C10330) for 20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SLC6S4/5-HTT (rabbit, 1:100 dilution, Thermo Fisher Scientific PA5-49572). Following immunostaining ...
-
bioRxiv - Neuroscience 2024Quote: ... coverslips were incubated with 1 µM NeutrAvidin for 5 min (Invitrogen, A2666), followed by 10 nM biotinylated anti-GFP antibody for 15 min (ABCAM ...
-
bioRxiv - Neuroscience 2024Quote: ... and passaged every 4-5 days with 1 mg/ml Dispase (Gibco). The human FUSWT line ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with primary antibodies (anti-ZO-1, 1:50, Life Technologies; anti-occludin, 1:50, Life Technologies; anti-claudin-5, 1:50, Life Technologies;) respectively at 4°C overnight ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA was radioactively 5' end-labeled using 1 U μl−1 T4 polynucleotide kinase (Thermo Fisher Scientific) and 0.5 μCi μl−1 32P-γ-ATP (PerkinElmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μl 10 μM 5‘-biotinylated oligo-dT30VN (IDT) and 1 μl 10 mM dNTP (Thermo Scientific). Cells were sorted at one cell per well ...
-
bioRxiv - Neuroscience 2020Quote: ... Caspase-3 (1:5000 anti-Rbt; CST; cat # 9662S) ERO1-L (1:1000 anti-Rbt; Thermo Fisher Scientific; cat # 702709) and β-Actin (1:3000 anti-ms ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmids (1 μg of sense and antisense guide RNAs + 3 μg donor for knockins) were diluted in 1 ml OptiMem (Gibco) and 20 μl of polyethylenimine (PEI ...
-
bioRxiv - Developmental Biology 2021Quote: Donor embryos were injected at the 1-cell stage with 3-5nL of 1% Dextran-FITC 10,000 MW (Molecular Probes) and 0.05% Phenol Red (to see the solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... AF6-88.5.5.3, #17-5958-82), CD119 (1:100, 2E2, #13-1191-82), Armenian Hamster IgG isotype (1:100, eBio299Arm, #13488881) (Invitrogen); CD45 (1:400 ...
-
bioRxiv - Developmental Biology 2022Quote: Organoids were treated immediately after PEG embedding for 3 days with neural differentiation medium comprised of a 1:1 mixture of neurobasal medium (GIBCO) and DMEM/F12 (GIBCO) ...
-
bioRxiv - Pathology 2020Quote: ... 6-dihydroxy-2,4,5,7-tetraio-dospiro (isobenzofuran-1(3H),9[9H] xanthan)-3:1 dipotassium salt (50 mg/kg in 0.9% saline, Fisher Scientific) was injected retro-orbitally before catalyzing vessel injury with a 540 nm laser ...
-
bioRxiv - Molecular Biology 2020Quote: ... To 1/3 of the sample 1/10 of the recommended amount of spike-in (ERCC RNA spike-in mix, Ambion) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... the media was replaced entirely with fresh retinal differentiation media (RDM) (DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX)) ...
-
bioRxiv - Cell Biology 2020Quote: ... the media was changed to retinal differentiation medium (RDM;DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX) ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibody in PBS supplemented with 3% BSA (Thermofisher, Mouse 800, 1:20000 and Thermofisher, Rabbit 680, 1:20000) was incubated in the dark for 1 hour on a rolling platform at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... the brains were placed in the secondary antibody solution containing 1xPBS/0.1% Triton X-100/3% donkey serum and a 1:1000 dilution of donkey anti-sheep 647 (A-21448, Thermofisher) for 10 days.
-
bioRxiv - Cancer Biology 2023Quote: ... Buffy coat was mixed 1:2 with PBS and added onto a Ficoll gradient in a 3:1 ratio (Invitrogen). This was centrifuged at 2100 rpm for 25 minutes at RT (w/o brakes) ...
-
bioRxiv - Systems Biology 2023Quote: ... The bottom tips were packed sequentially with three plugs of C18 membrane (3 M Empore) and mixed-mode ion exchange beads (SCX:SAX = 1:1, Applied Biosystems). The quantity of C18 membrane and mixed-mode ion exchange beads was adjusted based on the protein amount.
-
bioRxiv - Bioengineering 2023Quote: ... was reduced on the 78 ± 3 nm cores using 1 ml of 1 mM L-ascorbic acid (AA) (Fisher Scientific), making core@shell structures ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 1 µL mouse anti-V5 primary antibody (1:10,000; Invitrogen, R96025) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:3) (60) followed by secondary Alexa Fluor 488 goat α-mouse IgG antibody (Invitrogen / Thermo Fisher Scientific – 1:1,000).
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...