Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained for 5 min with Hoechst (1:10000 in PBS; Invitrogen), and after washing ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit polyclonal anti-nsp3 (Thermo Fisher, PA5-116947, 1:134, 5 µg/mL), sheep polyclonal anti-GFP (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... H2-Ld-PE (1:40; clone 30-5-7S; Invitrogen Cat. No. MA518007), CD45-PerCP-Cy5.5 (1:250 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary AlexaFluor-conjugated antibodies (Life Technologies; 1:500 in 5% BSA in PBS) with Hoechst 33342 dye were incubated for 1 h at room temperature in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were pulsed with 1 mM 5-Ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 3 hr ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 U Platinum™ Taq DNA Polymerase (5 U/ μL) (Thermo Scientific, USA), 0.2 μM each primer and 1 μL of purified DNA in a 25 μL final volume ...
-
bioRxiv - Cancer Biology 2024Quote: ... hydrocortisone 1 μg/ml (Voden, 74144) and Fetal Bovine Serum 5% (Gibco 10270106) and 1x PenStrep (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... A 10-µl drop of 5 mM OGB-1 (hexapotassium salt; Life Technologies) in ACSF was suspended from the upper electrode and lowered onto the retina ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rabbit antibody to pSMAD 1/5/8 (1:100; CST 9516) and mouse antibody to beta-amyloid (1:100; Invitrogen 13-200) were diluted in the same 3% blocking buffer and incubated overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and subsequently incubated in primary antibody solution (1:200 CD31 Dako IS610 + 1:200 CD10 Invitrogen PA5-85875 or 1:200 anti-laminin Abcam ab11575 or 5 μg/mL ZO-1 Invitrogen #61-7300) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: Ovaries from 5-7 females were dissected in 1% PBS-Tween and fixed in a 1:1 mixture of 4% formaldehyde (Thermo Scientific, 28908) and heptane (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were injected sub-cutaneously into the flank of adult mice at 1-5×106 cells per injection in a 1:1 mixture of serum-free Opti-MEM (Gibco, 31985-070) and Matrigel (Corning ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Qubit 3 (Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The sporozoite-infected culture was maintained for 3 or 5 or 7 days after which the cells were fixed with 4% paraformaldehyde (ThermoFisher Scientific: catalogue number 28906) for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... NCRM1 iPSCs were transfected with both Guide RNA vector (PSpCas9 (BB)-2A-GFP) and targeting vector (pUC19-5’HA-H2B-mCherry-P2A-3’HA) using Lipofectamine™ Stem Transfection Reagent (Thermo Fisher Scientific, STEM00001). 24-hours after transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... elegans cel-miR-67 (5’ UCACAACCUCCUAGAAAGAGUAGA 3’), using INTERFERin®-HTS transfection reagent (Polyplus-transfection SA, Illkirch France) or Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific Inc.). AntimiRs were used at a final concentration of 75 nM and transfections were performed according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cells were seeded in 6-well plates (5×105/well) were transfected with the indicated siRNA (3 μg) using Lipofectamine® 2000 transfection reagent (Life Technologies, 11668-019) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and HmlΔ-Reverse primer: 5’-GTTTAATTGTATACACAGGAAAATC-3’) were amplified from Drosophila genomic DNA and ligated into the pENTR™/D-TOPO™ vector (Invitrogen: Cat#K240020) for Gateway cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) and protein concentrations were determined with a Pierce BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Plant Biology 2022Quote: ... The cells were then incubated at their respective temperatures for 3 minutes prior to addition of 5 μM Sytox Green (Thermo Fisher Scientific, Loughborough, UK). All treatments were then incubated at 20 °C 15 min in darkness ...
-
bioRxiv - Molecular Biology 2022Quote: ... A final 5-minute 2xSSC wash was performed before the coverslips were mounted on a pre-cleaned frosted glass slide (Thermo Fisher, 12-552-3) with ProLong Diamond antifade reagent with DAPI (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... We then used the linearized MLM3613 as template to synthesize the 5′ capped and 3′ polyA-tailed Cas9 mRNA using the mMESSAGE mMACHINE® T7 Ultra Kit (ThermoFisher, cat no: AM1345) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... and shRNA plasmids or pCDH plasmids by PEI-40000 with the ratio of 5: 1: 5 in opti-MEM (Gibco, Thermo Fisher Scientific). Virions were collected after 48 h after transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... After 3 consecutive washes anti-rabbit Alexa Fluor-568 conjugated antibodies (1:500; Thermo Fisher Scientific) were applied for 2 h before counterstaining with DAPI.
-
bioRxiv - Microbiology 2020Quote: ... Parasitemias were determined on day 3 by staining with SYBR Green 1 nucleic acid stain (Invitrogen) at 1:2000 dilution in PBS/0.3% BSA for 20 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were further incubated with TO-PRO-3 Iodide (diluted in PBS, 1:2000, Life Technologies) at RT for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... then 500 μL volumes of blood were diluted in sterile PBS (1:3) (BR0014G, Thermofisher Scientific) and centrifuged at 500xg for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 1:3 of DNA: PEI in 200 μl of opti-MEM (Invitrogen) (Wang ...
-
bioRxiv - Neuroscience 2020Quote: ... or 3) Goat anti-rabbit conjugated with Alexa Fluor 647 (1:1000) (Life technologies, Carlsbad, CA) for 2 hours at room temperature protected from light ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-NP-induced cytotoxicity was measured by fluorescence using the die YOYO-1 (#Y3601, Life Technologies). Treated cells were placed in an Incucyte FLR imaging system and the YOYO-1 fluorescence was measured after several time points ...