Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FBS and antibiotics (penicillin 100 U ml−1, streptomycin 100 U ml−1 (pen/strep) (Gibco), 10mM glutamax (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... 5′-labelled Aar RNA (4 nM) was incubated for 1 h at 37°C with 1× structure buffer (Ambion), 1 µg yeast RNA and putative mRNA interaction partners at the indicated concentrations (0 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies were used at a ratio of 1:500 in 5% GS/1% BSA/0.2% PBST (anti-rabbit-Alexa-Fluor-555, Invitrogen A27039 ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: ... Incubation with primary antibodies (PARP1, Thermo Fisher, Cat#MA 3-950, TSG101, Thermo Fisher, Cat#MA 1-23296, both diluted 1:200) was done overnight at 4°C.
-
bioRxiv - Biochemistry 2020Quote: ... The wells were washed with 1% BSA/LBB and incubated for 1 hour with L9393 (1:5,000 dilution) in 3% BSA/LBB followed by incubation with Horseradish Peroxidase (HRP)-conjugated anti-rabbit IgG (Invitrogen, 1:5,000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... On the second day samples were washed (0.3% PBSTx, 3×1 hr) and subsequently incubated with the secondary antibody (Alexa-labelled GAM555 plus, Thermo Scientific, 1:1,000) overnight at 4°C ...
-
bioRxiv - Biophysics 2019Quote: ... The next day samples were washed (0.3 % PBSTx, 3×1 h) and incubated with the secondary antibody (Alexa-labelled GAM555 plus, Thermo Scientific, 1:1,000) overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Testes were homogenized manually followed by dropping 1 μl of suspension into 30 μl of hypotonic solution (1/3 of 1× PBS) and then dropped onto SuperFrost® slides (Menzel Gläser; Thermo Fisher Scientific). The samples were fixed in 400 μl of 2% PFA for 4 min ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-β-ACTIN (AB0145-200, SICGEN, 1:1000 or 3 ug/mL) and rabbit anti-GFP (A-6455, Invitrogen, 1:1000). The secondary antibodies used were Sheep IgG (H&L ...
-
bioRxiv - Genomics 2021Quote: ... and then blocked for 1 hour with 1 ml of blocking buffer (wash buffer containing 3% fatty acid free BSA (Thermo Fisher, 126609)) ...
-
bioRxiv - Cell Biology 2020Quote: The following antibodies were used: anti-cleaved-caspase 3 (1:200; CST, #9664s) and secondary Alexa Fluor 647 anti-rabbit (1:500; Invitrogen, #A-20991). Reagents including EN6 (Selleck ...
-
bioRxiv - Genomics 2022Quote: ... HEK293FT cells were replated at a 1:3 dilution one day post-transfection into media supplemented with 1 μg/mL final concentration puromycin (Thermo Fisher Scientific). HEPG2 cells (American Type Culture Collection (ATCC – HB8065 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes (min ...
-
bioRxiv - Physiology 2021Quote: ... The wells were washed with 1% BSA/LBB and incubated for one hour with L9393 (1:5,000 dilution) in 3% BSA/LBB followed by incubation with HRP-conjugated anti-rabbit IgG (Invitrogen, 1:5,000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... with 3 µg plasmid DNA and 1 × 106 cells in 100 µl Opti-MEM (1×) Reduced Serum Medium (Gibco® ThermoFisher Scientific). The electroporated cells were cultured in a non-selective complete medium in a 100 mm × 20 mm cell culture dish (Falcon ...
-
bioRxiv - Evolutionary Biology 2021Quote: For sucrose preference assays, experimental substrates were 1% agarose and contained 1% ethanol and increasing concentrations (200mM, 400mM or 600mM) of sucrose (ThermoFisher #S5-3); control substrates were 1% agarose and contained 1% ethanol.
-
bioRxiv - Bioengineering 2021Quote: ... HEK293FT cells were replated at a 1:3 dilution one day post-transfection into media supplemented with 1 µg/mL final concentration puromycin (Thermo Fisher Scientific). HEPG2 cells (American Type Culture Collection (ATCC – HB8065 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were washed in 0.1% Triton X-100 PBS for 3 × 10 min before incubation with either donkey anti-rabbit Alexa fluor 488 (Invitrogen, 1:1000) or donkey anti-mouse Alexa fluor 555 (Invitrogen ...
-
bioRxiv - Pathology 2022Quote: ... and cell monolayers were overlaid with 3 mL containing a 1:1 mixture of 1.2% oxoid agar and DMEM (Gibco, Carlsbad, CA, USA) with 10% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... (3) positive staining for IBA1 (rabbit primary, Wako, 019-1974, 1:2000, donkey anti-rabbit 647 Life Technologies, A-31573, 1:1000) via 2D immunofluorescence imaging and (4 ...
-
bioRxiv - Pathology 2023Quote: ... and cell monolayers were overlaid with 3 mL containing a 1:1 mixture of 1.2% oxoid agar and DMEM (Gibco, Carlsbad, CA, USA) with 10% (vol/vol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes at room temperature (RT) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by culturing with the neural induction medium supplemented with 20 ng/ml human FGF-2).61 The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted at 4000xg and pellets were washed with water (3 × 10 mL) and resuspended in 1 mL of water and 1 mL of TraceMetal Grade 70% HNO3 (Thermo Fisher Scientific). Acidified cell pellets were boiled at 90 °C for 1 hr and pelleted at 4000xg ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Microbiology 2023Quote: ... After lysis in breaking buffer (20 mM potassium phosphate, 5 mM EDTA, 1 mg mL−1 lysozyme, 1 Pierce Protease Inhibitor Tablet (Thermo Scientific, Rockford, IL), 1 mM DTT ...
-
bioRxiv - Microbiology 2021Quote: ... 5% human serum and 5% AlbuMAX-II (Gibco)) was replaced daily until reaching maturity at day 14-post induction ...
-
bioRxiv - Immunology 2023Quote: ... 2mg of 5-ethynyl uridine (5-EU, Thermofisher) was injected intraperitoneally at D12 following SRBC immunisation and similar preparation and labelling steps described for the ex vivo 5-EU assay were followed ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplification was used to add NotI/XbaI restriction sites to the 5’ and 3’ ends followed by digestion and ligation into a modified version of the pUASp vector (Invitrogen; kindly provided by Tom Millard) which confers ampicillin resistance and tags the construct N-terminally with eGFP (referred to as pUASp-eGFP) ...
-
bioRxiv - Molecular Biology 2019Quote: ... elegans cel-miR-67 (5’ UCACAACCUCCUAGAAAGAGUAGA 3’), using INTERFERin®-HTS transfection reagent (Polyplus-transfection SA, Illkirch France) or Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific Inc.). AntimiRs were used at a final concentration of 75 nM and transfections were performed according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Single colonies were inoculated in 3 mL LB broth (10 g/L peptone, 5g/L yeast extract, and 5 g/L NaCl) (Thermo Fisher Scientific, Waltham, MA, USA) containing the respective antibiotics at 37°C at 220 rpm overnight ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Immunology 2023Quote: ... D1-3 and D4-5 proteins were fluorescently labelled with Alexa Fluor™ 594 or 488 Microscale Protein Labeling Kits (Invitrogen™, A30008 or A30006) as described [15] ...
-
bioRxiv - Plant Biology 2020Quote: ... The synthesized cDNA samples were diluted 1:5 with diethylpyrocarbonate (DEPC)-treated water (Ambion). Semi-quantitative RT-PCR was performed using 2 μl of diluted cDNA as template and gene-specific primers (Supplemental Table S3) ...
-
bioRxiv - Physiology 2022Quote: ... AM (5 µM from a stock concentration of 1 mM in DMSO, ThermoFisher Scientific) and Pluronic F-127 (0.02 % from a stock concentration of 20 % in DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 μg.L−1 of epidermal growth factor (EGF) human recombinant (Thermo Fisher Scientific) (Wu et al ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 5 % fetal calf serum (PAN-Biotech) and 1 % Penicillin/Streptomycin (Thermo Fisher Scientific). The human Atoh8 expression plasmid [30] was transfected by electropulsing using the Cell Line Nucleofector System (Lonza ...
-
bioRxiv - Bioengineering 2021Quote: ... The composition of 1 L MM2 (pH = 6.9) was 5 g glucose (Acros Organics), 2.5 g of (NH4)2SO4 (Lach-Ner) ...
-
bioRxiv - Plant Biology 2021Quote: ... or 1/5 SuperSignal™ West Femto Maximum Sensitivity Substrate (34095, Thermo Fisher Scientific) was done using the ImageQuant LAS 4000 luminescent imager (GE Healthcare Life Sciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... in (i) 300μl MTH buffer along with MitoProbe™ DiIC1(5) (1:300; Invitrogen) or (ii ...
-
bioRxiv - Cell Biology 2021Quote: ... and CellMask DeepRed (1:1000 dilution from 5 mg/ml stock solution, Invitrogen C10046) for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... supplemented with 1× Halt Protease Inhibitor Cocktail and 5 mM EDTA (Thermo Fisher Scientific). Lysate was clarified by centrifugation and the total protein concentration was measured with the BCA Protein Assay (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Plant Biology 2022Quote: ... and Syto 13 Green Fluorescent Nucleic Acid Stain (5 μM mL-1, ThermoFisher Scientific) for 30 min at room temperature ...
-
bioRxiv - Bioengineering 2019Quote: ... cells were passaged 1:5 to uncoated Petri dishes by adding trypLE (Life Technologies) for 5 minutes to dissociate the cells before being resuspended in growth medium and plated.
-
bioRxiv - Cell Biology 2019Quote: ... counterstained with DAPI (1:2000) for 5 minutes and mounted in ProLong Gold (Invitrogen). Actin was visualized by phalloidin-AF647 staining (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... silencer siRNAs (5 nM) for indicated genes or Negative Control siRNA #1 (Ambion, AM4611) were transfected with Lipofectamin RNAi MAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Triethylamine and 5-hehyn-1-ol 97% were purchased from Acros Organics (Geel, Belgium). Deuterium oxide (D2O ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μM DAF-FM diacetate and 1 μM LysoTracker Red DND-99 (Life Technologies), respectively ...
-
bioRxiv - Bioengineering 2022Quote: ... consisting of 5 μL TaqMan Fast Virus 1-Step Master Mix (cat# 4444432, Thermofisher), 1.2 μL forward primer (0.6 μm) ...