Labshake search
Citations for Thermo Fisher :
8751 - 8800 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... in 384-well PCR plates (Thermofisher, AB1384) using the QuantStudio™ 12K Flex Real-time PCR System instrument (Thermofisher) ...
-
bioRxiv - Genetics 2022Quote: ... Subsequent PCR amplification by Phusion Polymerase (ThermoFisher) used UC1 (5’-GGTCCCAATTCTGCAGATATCCATCACAC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... using TaqMan Universal PCR Mastermix (Thermo Fisher). The sequence detection primers and the custom Taqman probe that were used in this study were synthesized by Integrated DNA Technologies (Table 1) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Systems Biology 2022Quote: ... 12.5 ul Phusion PCR master mix (ThermoFisher), 1.25ul of 10uM forward and 1.25ul of 10uM reverse primers were added to a total volume of 25ul ...
-
bioRxiv - Genetics 2022Quote: ... Subsequent PCR amplification by Phusion Polymerase (ThermoFisher) used UC1 (5’-GGTCCCAATTCTGCAGATATCCATCACAC-3’ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GeneJET PCR Purification Kit (Thermo Fisher Scientific) was used for PCR clean-up ...
-
FGF21 has a sex-specific role in calorie-restriction-induced beiging of white adipose tissue in micebioRxiv - Physiology 2022Quote: ... with Sybr Green PCR Master Mix (Invitrogen). Actin was used to normalize the results from gene-specific reactions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by ABI 7500 Q-PCR system (Applied Biosystems, USA). Reaction system conditions and primer sequences are detailed in the Supplementary Material ...
-
bioRxiv - Biochemistry 2023Quote: ... on StepOnePlus Real-Time PCR (Applied Biosystems).
-
bioRxiv - Cancer Biology 2024Quote: ... Power SYBR Green PCR Mix (Applied Biosystems), and primers were mixed following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viia7 Real Time PCR System (Life Technologies) and software was used for PCR and analysis.
-
bioRxiv - Biophysics 2023Quote: ... Phusion high-fidelity PCR master mix (Thermofisher) was used to perform PCR reactions ...
-
bioRxiv - Neuroscience 2024Quote: ... or pCR-XL-TOPO vectors (Invitrogen #K475010). The genes were moved to a FUGW vector for transient expression or lentivirus virus generation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Power SYBR Green PCR Mastermix (Applied Biosystems) was used to determine relative transcript levels ...
-
bioRxiv - Immunology 2024Quote: ... Sybr Green PCR Master Mix (Applied Biosystems) was used to carry out the reactions in an QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... SYBR Green PCR Master Mix (Applied Biosystems) was used in a CFX96 real-time thermocycler system (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Colony-PCR using OneTaq (Thermo Scientific™) was used to confirm the genomic integration ...
-
bioRxiv - Cancer Biology 2022Quote: ... using MagniTaq Multiplex PCR Master Mix (Affymetrix) and 12 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBRGreen PCR Master Mix (Applied Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... or a 7500 PCR system (Applied Biosystems). The qPCRs were performed in 10-µl reactions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Colony-PCR using OneTaq (Thermo Scientific™) confirmed the genomic integration ...
-
bioRxiv - Physiology 2022Quote: ... qRT-PCR was performed with SybrGreen (Invitrogen) and primers listed in Table S3 and amplification was detected on the QuantStudio 6 Flex (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... PowerSYBR Green PCR Master Mix (Applied Biosystems) was used and assays were run on a QuantStudio 6 Pro (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Phire Plant Direct PCR kit (Thermo Scientific) was used with primers listed in Table S2 to amplify parts of the MpROP genomic sequence ...
-
bioRxiv - Developmental Biology 2023Quote: ... Power SYBR Green PCR Mastermix (Applied Biosystems) was used to determine relative transcript levels ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR used TaqMan Assay probes (Applied Biosystems) and RNA was isolated using the miRNeasy kit (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed using Phusion polymerase (Invitrogen) with the following cycling parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... GeneJET PCR purification kit (Thermo Scientific, K0701) was used for all dsDNA purification ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were performed using DreamTaq (ThermoFisher: EP0701), with 30 seconds of extension time and an annealing temperature of 60°C for 35 cycles.
-
bioRxiv - Microbiology 2023Quote: ... 2.5μL 10X High Fidelity PCR Buffer (Invitrogen), 0.5μL 10 mM dNTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and real-time quantitative PCR (Applied Biosystems), using a primer set for probing EGR1 mRNA (Table S1).
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were treated with ExoSAP (Affymetrix) and sequenced using NF1-exon3-SEQ (TGCCATTTCTGTTTGCCTTA).
-
bioRxiv - Synthetic Biology 2023Quote: ... GeneJET PCR Purification Kit (Thermo Scientific™) was used for PCR clean-up ...
-
bioRxiv - Biochemistry 2023Quote: ... PowerSYBR Green PCR Master Mix (Applied Biosystems), cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... using MagniTaq Multiplex PCR Master Mix (Affymetrix) and 12 cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... SYBR Green PCR Master Mix (Applied Biosystems) was used to perform quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... with ProFlex PCR System (Applied Biosystems, USA). qRT-PCR was performed on QuantStudio 12 K Flex (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sybr Green PCR Master Mix (Thermo Fisher), 5 µM of sense and antisense primers (sequences listed in Resource Table).
-
bioRxiv - Developmental Biology 2023Quote: ... in a Veriti PCR thermocycler (Applied biosystems). Samples were cycled once at 25°C for 10 minutes ...
-
bioRxiv - Physiology 2023Quote: ... or GeneJET PCR Purification Kit (Thermo Fisher). Sanger (Etion Bioscience Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... in a Veriti PCR machine (Applied Biosystems). List of primers used are found in Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... or GeneJET PCR Purification Kit (Thermo Fisher). Sanger sequencing was used to verify each mutant ...
-
bioRxiv - Bioengineering 2023Quote: ... and SYBR Green PCR master mix (ThermoFisher). The qPCR was run on a CFX Connect real-time qPCR machine (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... A QuantStudio Real-Time PCR System (ThermoFisher) thermocycler was used following standard cycling conditions ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... SYBR Green PCR master mix (Applied Biosystems) and a Step-One PCR instrument (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... a CloneJET PCR cloning kit (Thermo Scientific) and DNA purification using a Wizard SV 96 plasmid system (Promega ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR products were recombined into pDONR207 (Invitrogen) using Gateway® BP Clonase® II Enzyme mix (Invitrogen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... into 96 well PCR plates (Thermo Scientific) containing 2μl of lysis buffer (0.1% Triton X-100 ...