Labshake search
Citations for Thermo Fisher :
8601 - 8650 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... along with Super Script II Reverse Transcriptase (18080–044) and random primers (48190–011) (both from Life Technologies), in a 20 µl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription was conducted with random primers using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). DDX39B and FOXP3 RNA levels were measured by real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Developmental Biology 2021Quote: ... according to manufacturers instruction on 100ng of RNA and using a mix (1:1) of random primers (Invitrogen) and oligo dT (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... Sequence information for the primers contained in the Taqman assays is provided here: Taqman probes (Thermo Fisher Scientific): Tcf7l2 mouse (Mm00501505_m1) ...
-
bioRxiv - Microbiology 2020Quote: ... 106.15 ZIKV genome copies were converted to cDNA with Superscript IV reverse transcriptase and random hexamer primers (ThermoFisher). PCR amplification of the entire ZIKV coding region was then performed in two reactions with pools of non-overlapping PCR primer sets ...
-
bioRxiv - Plant Biology 2021Quote: ... The first-strand cDNA was synthesized using the Superscript III reverse transcriptase and oligo dT primer (Life Technologies) according to the instructions from the manufacturer ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting cDNA underwent qPCR using gene-specific primers with the SYBR Green qPCR Assay system (Applied Biosystems). Primer sequences for qPCR are listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthetized using SuperScript™ III First-Strand Synthesis System and random hexamers primer (Thermo Fisher, USA).
-
bioRxiv - Genomics 2019Quote: ... cDNA was prepared using Oligo (dT)18 primer with a High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific). Then ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was synthesized from 5 µg RNA with 0.5 µg of oligo(dT)12-18 primer (Thermo Fisher) using SuperScript III reverse transcriptase (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the forward and reverse primers (Tables S6) were mixed with SYBR Green Gene Expression Master Mix (Applied Biosystems) in 10 μl total reaction volume.
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was reverse-transcribed to cDNA using oligo(dT) primers and M-MuLV reverse transcriptase (Thermo Fisher Scientific). PCRs were run with PrimeSTAR GXL DNA Polymerase (Takara ...
-
bioRxiv - Bioengineering 2020Quote: ... Details on the primers and probe sequence as well as catalogue numbers of Assay-on-Demand (Applied Biosystems) are listed in supplementary (Tab A1).
-
bioRxiv - Microbiology 2019Quote: cDNA was synthesized using Random Hexamer primers and RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific; Waltham, MA). To check the amplification efficiency of the primers ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from the mRNA using random primers and the SuperScript III First-Strand Synthesis System (Invitrogen). SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primers (Integrated DNA Technologies) were used to sub-clone GABAB constructs into the pFastBacDual vector (Invitrogen) with N-terminal Flag epitope (DYKDDDD ...
-
bioRxiv - Genomics 2019Quote: ... A conventional amplification using DENV-2 specific primers (Table S1) were generated with Taq polymerase (ThermoFisher, Waltham, MA). Random amplicons were obtained using SuperScript III RT and HiFi Taq (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain derived cDNA and primers targeting mouse a-Syn (see table) were used in Syber Green (Thermo Fisher) Real Time PCR reactions monitored by a 7500 Fast Real Time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA samples were first reverse-transcribed into cDNA using random primers and Superscript IV reverse transcriptase (#18091050, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Specific primers were used to amplify CAL1 and GAPDH as housekeeping control using Phusion Taq polymerase (Thermo Scientific). Reaction conditions and annealing temperatures followed the manufacturer’s suggestions ...
-
bioRxiv - Genomics 2020Quote: ... We reverse-transcribed 1 μg of total RNA using random hexamer primers and RevertAid Reverse Transcriptase (Thermo Fisher) at 25°C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3X Flag PCR fragment including NTCP coding sequence was amplified using the NTCP_FWD (CACCATGGATTACAAGGATGACGACGATAAGGATTACAAGGATGACGACGATAAGGATT ACAAGGATGACGACGATAAGATGGAGGCCCACAACGCGTCTgcccca) and NTCP_REV (TTACTAGGCTGTGCAAGGGGAGCA) primers and cloned in the pENTR/D-TOPO entry vector (Invitrogen) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... sequenced using the T3 and T7 plasmid primers and analyzed using an ABI 310 Genetic Analyzer (Applied Biosystems). The obtained sequences were examined through BLAST analysis.
-
bioRxiv - Microbiology 2019Quote: ... the PBANKA_1003900 promoter (1.7 kb) was amplified using primers GCTCTACCAATTTTGTGTCAC and GGATCCTTAAAAATTAATTTTGTATAAAATCG and cloned into pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA samples were first reverse transcribed into cDNA using random primers and Superscript IV reverse transcriptase (#18091050, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 5 µg of RNA with random primers using Superscript II Kit (Invitrogen, Thermo Fisher). Real-time quantitative PCR was performed with Taqman probes from Applied Biosystems (Hs01568763_m1 for RAD51B ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 5 µg of RNA with random primers using Superscript II Kit (Invitrogen, Thermo Fisher). Real-time quantitative PCR was performed with Taqman probes from Applied Biosystems (Hs01568763_m1 for RAD51B ...
-
bioRxiv - Genomics 2019Quote: ... We ran all primer tests in duplicate on an Applied Biosystems StepOnePlus (Thermo Fisher Scientific, Waltham, MA, USA) using the following conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... aeruginosa PAO1 using the specific primers listed in Table S4 with High-Fidelity DNA polymerase (Thermo-Fisher Scientific). Primers were designed to generate XhoI and HindIII restriction sites at 5’end and 3’end of the PCR product ...
-
bioRxiv - Physiology 2020Quote: ... 600 nM of HIV gag reverse primer and 5 U of Platinum Taq DNA polymerase (Life Technologies; USA). In the 2nd round PCR 5’ LTR region of HIV-1 was amplified using 1 μl of 1st round PCR amplicon as a template ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from 1 μg of total DNase-treated RNA using 300 μM of random primers (Invitrogen) and the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... 25 ng of cDNA and 0.5 μM of primers using an ABI Prism 7900HT (Thermo Fisher, Waltham, MA) in the qPCR CoRE at Icahn School of Medicine at Mount Sinai ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (1μg) was retro-transcribed using random primers and the SuperScript III First-Strand Synthesis system (ThermoFisher Scientific). For RT-QPCR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used random hexamer primers for cDNA reverse transcription in this case (Thermo Fisher Scientific, Waltham, MA USA).
-
bioRxiv - Genomics 2021Quote: ... Fragment mRNA was then incubated with 0.5 μl of Random primers (3 mg/mL) (Thermo Fisher Scientific 48190011), 0.5 μl of 50mM Oligo dT primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... using random primers and a high-capacity cDNA reverse transcription kit following the included protocol (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2022Quote: ... Extension products were separated from unextended primer oligos by capillary electrophoresis using a 3500 Series Genetic Analyzer (ThermoFisher) to achieve single base resolution ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA synthesized using a gene-specific reverse primer and SuperScript III First-Strand Synthesis System (Thermo Fisher) according to manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... juncea genomic DNA with forward and reverse primer and cloned in pGEMT-T Easy plasmid (Invitrogen, Madison, WI). The sequence spanning the last 191 bp and 199 bp of the protein-coding regions of CaMATE1(MtMATE1 ...
-
bioRxiv - Systems Biology 2023Quote: RNA was reverse-transcribed from annealed fluorescent primer in a reaction containing 1× First Strand Buffer (Thermo Fisher), 5 mM DTT ...
-
bioRxiv - Microbiology 2024Quote: ... pRS1841 was PCR-amplified using primers sdm_GlnA_R66A_for (5’ATTGAAGAAAGCGATATGAAACTGGCGC3’) and sdm_GlnA_R66A_rev (5’CGCGGTAAAGCCCTGAATGCTGCTACC3’) by Phusion High-Fidelity polymerase (Thermo Fisher Scientific, Waltham, Massachusetts) followed by religation resulting in plasmid pRS1951 ...
-
bioRxiv - Neuroscience 2022Quote: 250 ng of total RNA was reverse transcribed using stem-loop Multiplex primer pools (Applied Biosystems, Dublin, Ireland). We used reverse-transcriptase-specific primers for mmu-miR-134 (Applied Biosystems miRNA assay ID 001186 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Resulting RNA samples were then reverse transcribed into cDNA using the primer Prdm9intron9 and SuperScript IV (Life Technologies), following manufacturer’s protocol ...
-
Simultaneous adjunctive treatment of malaria and its co-evolved genetic disorder sickle cell anaemiabioRxiv - Microbiology 2022Quote: ... pfr2 (GenBank accession no. U01322.1) and pfr4 (GenBank accession no. AY669809.1) genes were designed with Primer Express software 3.0 (Applied Biosystems). The primers and probes from pfmdr1 and β-tubulin genes (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was carried out with TaqMan® probe/primers (Applied Biosystems; see Table S3 for Unique assay IDs). Beta-actin (ACTB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNAs were synthesized from the total RNA using Superscript IV reverse transcriptase with random primers (Thermo Fisher Scientific). Quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was synthesized using 50ng/ul random primers and 50uM Oligo(dT) with SuperScript IV reverse transcriptase (Invitrogen). qPCR was performed using Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ug of RNA isolated from JE2 WT was subjected to reverse transcription by using 5՚-phosphorylated primer pepV_TSS_R1 and the first strand cDNA synthesis kit (Invitrogen, Superscript III First-Strand Synthesis System) ...
-
bioRxiv - Cell Biology 2023Quote: Primers sequences targeting the open reading frames (ORF) of genes of interest (GOI) were taken from the LeishGEdit primer database (www.LeishGEdit.net) and sourced from ThermoFisher. Due to high sequence similarity ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA (1 μg) was retrotranscribed using random primers and a SuperScript III First-Strand Synthesis system (Invitrogen 18080051). For qRT-PCR ...