Labshake search
Citations for Thermo Fisher :
8551 - 8600 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... followed by RT-qPCRs using TaqMan Assays and TaqMan Gene Expression Master Mix (both Applied Biosystems, USA) on the CFX384 C1000 Thermal cycler (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2024Quote: For RT-qPCR cDNA was generated using the High Capacity Kit (Applied Biosystems™, cat. no. 4368814) according to the manufacturer’s protocol using 1 μg RNA ...
-
bioRxiv - Microbiology 2024Quote: RT was performed on 6 µl of eluted RNA using MMLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) with dT17 primer (for polyadenylated transcripts) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA strand synthesis and RT-qPCR were done with SuperScript IV VILO cDNA synthesis kit (Invitrogen, #11756050) and PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... and qPCR was performed using let-7 and 2S rRNA TaqMan MicroRNA Assay primer mix (Thermo Fisher Scientific) with the TaqMan Small RNA Assay (Applied Biosystems).
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: ... all 384 wells were pooled within each plate and excess oligoDT primer removed using ExoSAP-IT Express (Affymetrix) at 37C for 20mins ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was reverse transcribed using random primers (High Capacity cDNA Reverse Transcription kit, Applied Biosystems, Foster City, CA). Gene expression was assayed by real-time PCR using Taq-Man Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... This was used to generate cDNA using a gene specific reverse primer and RevertAid Reverse Transcriptase (Thermo Scientific). These genes were then amplified from cDNA using respective forward primers and reverse primers (Table 2) ...
-
bioRxiv - Developmental Biology 2021Quote: ... mRNA (1μg) was retro-transcribed using oligo(dT) primers and the SuperScript III First-Strand Synthesis System (Invitrogen). To amplify the region targeted by the MO (supplemental Fig ...
-
bioRxiv - Immunology 2021Quote: ... all 384 wells were pooled within each plate and excess oligoDT primer removed using ExoSAP-IT Express (Affymetrix) at 37C for 20mins ...
-
bioRxiv - Microbiology 2020Quote: ... 2020) using the V.3 multiplex primers scheme and Platinum Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific). Positive PCR products were purified with the ReliaPrep™ DNA Clean-Up and Concentration System (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5pmol of primer (5µl of 5 µM stocks) were end-labeled with 10 units of USB Optikinase (Affymetrix), and 7 µl of 6,000Cu/mmol ATP-ɣ32P (Perkin-Elmer ...
-
bioRxiv - Immunology 2020Quote: ... Reverse transcription was performed using M-MLV Reverse Transcriptase and random primers following manufacturer’s instructions (Thermo Fisher Scientific). Gene-specific primers were designed over different exons to prevent amplification of genomic DNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primers (Integrated DNA Technologies, Leuven, Belgium) were used in qPCR with SybrGreen® qPCR Master Mix (Applied Biosystems). qPCR experiments were carried out in the Fast Real-Time PCR System® apparatus (Applied Biosystems).
-
bioRxiv - Microbiology 2022Quote: ... and reverse transcribed at 42°C using an oligo dT primer and SuperScript II reverse transcriptase (Life Technologies) as per manufacturers’ protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA by PCR with gene-specific primers DONR-Mp64_F and DONR-Mp64_Rev (Table S2.) The amplicon was cloned into entry vector pDONR207 (Invitrogen) using Gateway cloning technology ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequenced with T7 and SP6 primers using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, 4337454) in a 3730xl DNA Analyzer (Applied Biosystems).
-
bioRxiv - Molecular Biology 2021Quote: ... Using primers PseudoRFPF ( CAACAAAATTATAGCAGAATGCAACGTCGACAAAAGGCTCAAGAAATTAACGGCCTACAC GCGGGTCCCATTGTTTGCCTCT) and PseudoPACR ( GTTTTGGCGCGTTGTTCCGTATCTGCTGAGCAAACCTTTTGCGCCGGCTGCTGCGGCGGATAACTATTTTCTTT GATGAAAG) we amplified the RFPscePAC cassette using Phusion Polymerase (ThermoFisher). 5 μg of PCR product was used for transfection using standard protocols ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNAs (1 µg) were reverse-transcribed into cDNAs using random primers and SuperScript III reverse transcriptase (Invitrogen) for 1 h at 50 °C ...
-
bioRxiv - Immunology 2022Quote: ... The primer used against mouse ST6Gal1 was Taqman Mm00486119_m1 and expression was normalized against β2-microglobulin expression with primer probe Mm00437762_m1 (ThermoFisher).
-
bioRxiv - Immunology 2021Quote: ... Synthesis of the first strand cDNA was performed using SuperScript II reverse transcriptase and oligo (dT) primer (Invitrogen). qPCR was performed with the CFX96 real-time system (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... First strand cDNA synthesis was performed using an oligo(dT)18 primer and RevertAid reverse transcriptase (Thermo Scientific) under standard conditions ...
-
bioRxiv - Genomics 2019Quote: ... four 50ul reactions were conducted using the M13f and P505 primers and Platinum Taq (Invitrogen cat. 10966-034). The four reactions were then combined and purified in a Qiagen Minelute spin column (cat ...
-
bioRxiv - Physiology 2019Quote: ... and 1 µL of either dystrophin (Dmd) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe/primer mix (Applied Biosystems; Mm00464475_m1 and Mm99999915_g1 ...
-
bioRxiv - Genetics 2019Quote: ... 23μl of eluted genomic DNA was mixed with 1μl of forward and reverse primer (10μM) and 25μl of AmpliTaq Gold 360 Master Mix (ThermoFisher, 4398881). The PCR program was ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 μg of RNA was reverse transcribed using oligo dT primer either by Superscript III Reverse Transcriptase (Invitrogen) for tobacco or by RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... or ssDNA M13 primer was labelled using the Ulysis Alexa Fluor 647 nucleic acid labeling kit (Thermo Fisher) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... and then cDNA was synthesized from 5µg RNA using polyT primers included with Superscript III Reverse Transcriptase (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... by the addition of a 50 nM pre-designed siRNA primer pair CCAGGAAAUUAGCAAGGGATT (sense) and UCCCUUGCUAAUUUCCUGGGT (antisense) (Ambion/Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... qPCR reactions were prepared using gene-specific primers and Platinum SYBR Green qPCR Supermix-UDG (Thermo Fisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The reverse transcription was performed using random primers with the High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific). For the cDNA amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... it was reacted using M13 primer and a BigDye terminator v3.1 cycle sequence kit (Thermo Fisher Scientific, 4337455), and gene sequences were analyzed by a 3130 Genetic Analyzer (Thermo Fisher Scientific).
-
bioRxiv - Bioengineering 2021Quote: Primer efficiency was determined by preparing qPCR reactions with PowerUp SYBR® Green Master Mix (Life Technologies™), with a 5x dilution series of cDNA (500ng/μL - 0.0061ng/μL) ...
-
bioRxiv - Bioengineering 2021Quote: ... The annealed primer and total RNA was mixed with 4 µL of 5x SSIV buffer (#18090050B, ThermoFisher Scientific), 1 µL 100 mM DTT ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg RNA was used to prepare cDNA using random primers (total reaction volume = 20 μL; Applied Biosystems High-Capacity Reverse Transcription Kit) ...
-
bioRxiv - Microbiology 2021Quote: ... with SARS-CoV-2 N-specific primers (EV Table 1) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was performed in parallel using purified SARS-CoV-2 viral RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... a final concentration of 200 nM of each (forward and reverse) SYBR green-designed primers (Thermo Fisher Scientific), and 10 ng of cDNA template per reaction ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 μM of forward and reverse primers and 12.5 μL of SYBR® Green Master Mix (Life Technologies) in a 25-μL reaction mix.
-
bioRxiv - Biochemistry 2020Quote: ... the svi3-3 gene was PCR amplified using Pfu DNA polymerase with primers Svi3-3_d19f and Svi3-3_r1 and cloned into the pEXP5-NT/TOPO vector (Invitrogen) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.48 µL of 4 μM “universal” M13 primer labeled with VIC fluorescent dye (Applied Biosystems, Foster City, CA), 0.2 µL of 5.0 U µL-1 taq polymerase (Sigma Jumpstart™ ...
-
bioRxiv - Microbiology 2020Quote: ... The first strand was reverse transcribed with primer FR26RV-N using Superscript III enzyme (Life Technologies, Carlsbad, CA), followed by complementary strand synthesis using Sequenase polymerase (Affymetrix ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was mixed with 10 µM forward and reverse primers and PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The resulting RNA was reverse transcribed using Multiscribe reverse transcriptase and a gene-specific primer (Thermo Fisher Scientific), and the resulting cDNA was purified using alkaline lysis of the RNA ...
-
bioRxiv - Microbiology 2021Quote: ... and reverse transcribed at 42°C using an oligo dT primer and SuperScript II reverse transcriptase (Life Technologies) as per manufacturers’ protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... reverse primer: CTAAACATAAAAGACTTGTCCAACG) on Col-0 cDNA synthetized from 1 µg RNA with SuperScript™ III kit (Invitrogen). Sequencing of PCR products (GATC Biotech ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1μl of forward and reverse primer (10μM, IDT) and 25μl of AmpliTaq Gold 360 master mix (Thermo Fisher). The PCR program was ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using random hexamer primers and Superscript II reverse transcriptase (Invitrogen). Diluted cDNAs (1/10 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 500 or 750 ng of RNA were reverse transcribed using SuperScript II Reverse Transcriptase and Random Primers (Invitrogen). Quantitative PCR were assayed as described for patient samples.
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was reverse transcribed with random primers using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). QPCR was performed using Roche’s SYBER Green detection in the Lightcycler 480 (Roche) ...
-
bioRxiv - Pathology 2022Quote: ... viral vectors and packaging vectors were transfected into 293T cells using Jet Primer (ThermoFisher Scientific, Waltham, MA, USA). ...