Labshake search
Citations for Thermo Fisher :
8501 - 8550 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... and heated at 95°C for 5 min before loading onto a NuPAGE Bis-Tris 4-12% gel (Invitrogen). Immunoblotting was performed using a Mini Trans-Blot cell (BioRad ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were loaded on a C18 PepMap100 pre-column (300 µm i.d. x 5 mm, 100Å, Thermo Fisher Scientific) at a flow rate of 12 μL/min in 100% buffer A (0.1% formic acid (FA ...
-
bioRxiv - Biochemistry 2022Quote: ... The urea-denatured LipA was incubated in 25-fold molar excess of fluorescein-5-maleimide (FM, Thermo Fisher Scientific) for 3 h at the ambient temperature ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs from both treated and untreated arms of the experiment were separated on a 5% denaturing acrylamide:bisacrylamide (19:1) gel alongside a RiboRuler Low Range RNA Ladder (ThermoFisher) and the gel fixed ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 5×105 naïve HEp-2 cells were stained with Vybran DIO Cell-Labeling Solution (0.005 μg/ml, Thermo fisher) for 20 min at 37 °C and washed with PBS ...
-
bioRxiv - Microbiology 2022Quote: ... Macrophages were maintained at 37°C with 5% CO2 in Dulbecc’s Modified Eagle Medium + GlutaMAX (DMEM, Gibco 61965-026) supplemented with 10% heat-inactivated fetal calf serum (FCS ...
-
bioRxiv - Biophysics 2022Quote: ... U2OS cells were cultured at 37°C in a humidified atmosphere with 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) supplemented with 10% FBS (Fetal Bovine Serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was rotated at 37 °C for 45 min in 1 mg/mL papain suspended in digestion buffer (5% w/v D-trehalose, 0.05 mM APV, 0.0125 mg/mL DNAse, in HibernateTM-A (Thermofisher, A1247501)) ...
-
bioRxiv - Biophysics 2022Quote: ... Blocking was performed for 2 hours at room temperature with 1X PBS supplemented with 5% Fetal Bovine Serum (Invitrogen) and 0.25% Tween-20 (Invitrogen ...
-
Long-term cellular cargo tracking reveals intricate trafficking through active cytoskeletal networksbioRxiv - Biophysics 2022Quote: ... cells were maintained at 37 °C in a humidified 5 % CO2 and 95 % air atmosphere in Dulbecco’s modified eagle medium (DMEM) (Gibco) supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were cultured in a humidified incubator at 37 °C with 5% CO2 and passaged using 0.25 Trypsin-EDTA (Invitrogen). The cell culture medium was replaced every three days ...
-
bioRxiv - Bioengineering 2022Quote: ... All cells were cultured in temperature and humidity-controlled incubator (5% CO2, 37°C, Thermo Fisher Scientific, Rochester, NY) and were grown until 70% confluence and used within the first eight passages.
-
bioRxiv - Cell Biology 2022Quote: ... The qPCR reactions were performed in triplicates using a QuantStudio 5 Real-time PCR System (Thermo Fisher, cat#A34322) using the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were maintained in a humidified 5% CO2 incubator at 37 °C and subcultured by 0.05% trypsin–0.5 mM EDTA solution (Gibco Life Technologies). Once the confluences reached suitable percentages ...
-
bioRxiv - Bioengineering 2022Quote: ... The following reagents were used as received: 2,4,6-trinitrobenzene sulfonic acid 5% weight/volume methanol solution (Thermo Fisher Scientific), N-Boc-hydroxylamine (Alfa Aesar) ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 T cells at the end of expansion were harvested from culture and washed in cold PBS (ThermoFisher). The cell pellet was resuspended in ice-cold 1x RIPA buffer (Cell Signaling Technologies ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ and CD8+ T-cells were stained with LysoTracker Red DND-99 (Invitrogen; 5 μM; 1 h; 37°C), fixed (3% PFA ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transduced with respective sgRNA and selected with 5 - 10 μg/ml blasticidin S HCl (Thermo Fisher, # A1113903) or 2 - 5 μg/ml Puromycin Dihydrochloride (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: Vero E6 cell line was grown at 37°C in a 5% CO2 condition in Dulbecco’ modified Eagle’s medium (DMEM) containing 10% FBS (Gibco). For the host protein response screen 10,000 cells/well were seeded on 96 well microplates (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Selection was applied to transfectants for at least 5 passages prior to use: 150 µg/ml hygromycin-B (ThermoFisher) and 1 µg/ml puromycin (ThermoFisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... appropriate amounts of DNA were incubated for 5 minutes in Opti-MEM reduced serum medium (31985070, Thermo Fisher Scientific) and gently mixed with an equal volume of Lipofectamine 2000 in Opti-MEM ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue was rinsed in PBS (2 × 5 min) and placed in a 9 mm wide × 0.5 mm deep gasket (Invitrogen) on a glass slide that was previously coated with Poly-L-Lysine (1 µl ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Biochemistry 2020Quote: SHSY5Y cells were obtained from the Duke University Cell Culture Facility and were maintained at 37 °C with 5% CO2 in DMEM:F12 (1:1; Gibco) supplemented with 10% FBS (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: The TSS of PlAMV sgRNA was detected in 5′ RACE analysis using a GeneRacer Kit (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated at 1 x 10^6 cells per well of a 6 well plate or 5 x 10^6 cells per T25 flask in stage 2 media consisting of 47.5% IMDM (Gibco), 47.5% F12 (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... brains were transferred through 4 wells containing a blocking solution (5% Goat Serum in PBT; Life Technologies #16210-064), and sitting in the last well for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked with PBS-0.05% Tween 20 (PBS-Tween) containing 5% nonfat milk (Fisher Scientific, Pittsburgh, PA), and the membranes were washed three times and incubated with primary antibody in 1% milk PBS-Tween at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Purified vesicles were covalently labelled with an amine-reactive Alexa Fluor 488 5-SDP ester dye (Molecular Probes/ThermoScientific).
-
bioRxiv - Immunology 2020Quote: Non-transduced and CAR T cells were stained at 37°C with either 1μM 5-chloromethylfluorescein diacetate (CMFDA; Invitrogen) for 5 minutes or 125nM calcein red orange for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... cells were maintained at 37°C and 5% CO2 in a humidified atmosphere and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... APP-KI and WT mice were plated onto 24 well plate at a density of 2×105 cells per well and cultured for 24 hours in a humidified 5% CO2 incubator at 36.5°C in DMEM/F12 media (Invitrogen) supplemented with 10% heat inactivated FCS (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: Complement-labelled bacteria (~5 × 107 bacteria/ml) were incubated with 2.5 μM of Sytox Blue Dead Cell stain (Thermofisher). Samples were diluted to ~2.5 × 106 bacteria/ml in RPMI-HSA and subsequently analyzed on a MACSquant VYB (Miltenyi Biotech ...
-
bioRxiv - Cell Biology 2019Quote: ... 15 μg of mitochondria were resuspended in 500 μL mitochondrial isolation buffer containing 5 μM MitoSox Red (ThermoFisher, M36008) and 100 μM MitoTracker Green FM with or without 10 mM sodium succinate ...
-
bioRxiv - Developmental Biology 2020Quote: ... 90% of each cell lysate was centrifuged at 13,000 rpm for 5 minutes and the supernatants were transferred and incubated with streptavidin beads (Dynabeads M-280, Invitrogen), which were already blocked by 0.2% Chicken Egg Albumine (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The testes were then washed with two portions of PBST and incubated in PBSTX (0.1% Tween-20 and 0.3% Triton X-100 in 1×PBS) with 5% normal goat serum (Life Technologies) at room temperature for at least 1 h ...
-
bioRxiv - Neuroscience 2021Quote: iMD3 cells were thawed (or replated) on laminin521-coated plates with 5% KSR medium+20ng/ml hFGF (CTP0263, Invitrogen) + 10µM RI for 3days with a seeding density of 2.5 × 106 cells per laminin-521-coated 10cm dish ...
-
bioRxiv - Molecular Biology 2020Quote: ... and dialyzed in PBS with 5% sorbitol with 10K MWCO Slide-A-Lyzer G2 Dialysis Cassette (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... diluted in 1 X TBST [100 mL of 10 × 1L Stock (90 g Tris Base (Fisher Scientific, BP152-5), 88 g NaCl (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 ng control pSV40-Renilla vector plus 0.2 μl Lipofectamine 2000 in 25 μl OptiMEM (both from Thermo Fisher). For Fig ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were plated in 6 well plates and transfected with 5 μl Lipofectamine RNAiMAX transfection reagent and siRNAs (Invitrogen) at 50 nM final concentration according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... SEM images were acquired on a FIB-SEM platform (Helios 5 UX DualBeam, Thermo Fisher Scientific, Brno, Czech Republic) using SEM imaging mode at 5 kV and 0.1 nA with TLD and ICD detectors.
-
bioRxiv - Immunology 2021Quote: ... then treated with DNAse I at room temperature (RT) prior to incubation with 5 µM Sytox Green (Thermo Fisher) and quantification via fluorimetry using a Perkin Elmer plate reader ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes and incubated in DAPI (Invitrogen Molecular Probes D1306 ...
-
bioRxiv - Neuroscience 2021Quote: ... membranes were incubated in milk (5% in Tris-buffered saline with 0.1% Tween-20 – TTBS, or SuperBlock – Thermo Scientific) to block non-specific binding sites during 1 h at RT ...
-
bioRxiv - Neuroscience 2021Quote: Cell cultures (astrocytes or neurons) were incubated for 30 min at 37 °C in 5 µM rhodamine123 solution (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Microbiology 2021Quote: ... and an Acclaim PepMap 100 trap column (100 μm x 2 cm, nanoViper, C18, 5 μm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% ACN / 0.1% formic acid at a flow of 250 nl/min for 120 min and analyzed with a QExactive Plus mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... followed by rehydration in a graded ethanol series (100%, 75%, 50% and 25%) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Immunology 2019Quote: ... Bone marrow (BM) cells were harvested from femurs by repeatedly flushing with PBS supplemented with 5% FBS (Life Technologies). The analysis of BM cellularity was performed with MACSQuant (Miltenyi Biotec) ...