Labshake search
Citations for Thermo Fisher :
8301 - 8350 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The fixed cells were washed with PBS and blocked with 5% goat serum for 1 hr (Thermo Fisher, 31872). Mouse anti-T7 primary antibody (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... 25 pmol of siRNA were mixed with 5 µL of Lipofectamine RNAiMAX in 500 µL of Opti-MEM (Invitrogen) in a 6-well plate ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA of E12.5 neural tube tissue was extracted using the Ambion Purelink RNA mini kit according to the manufacturer’s instructions (ThermoFisher). Invitrogen Purelink DNase (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... for 14 days and validated by transfection with 5 µg Cre recombinase plasmid using LipofectamineP3000 (ThermoFisher Scinetific Waltham, MA). After 24h and 48h ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled RNA was incubated 5 min at 90°C with alkaline buffer or 5 min at 37°C with ribonuclease T1 (0.1 U; Ambion) to generate the Alkaline (OH ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... to the tube was added a solution of 0.269 mg of P58 mixed 5:1 by volume with salmon sperm DNA (Invitrogen), followed by 3 mL of 39.52% polyethylene glycol ...
-
bioRxiv - Developmental Biology 2020Quote: Cas9 mRNA/sgRNA injection solution was prepared to 5 mg/ml fluorescein-labeled dextrans (10,000 MW, Thermo Fisher Scientific), 20% glycerol ...
-
Planarian CREB-binding protein (CBP) gene family regulates stem cell maintenance and differentiationbioRxiv - Developmental Biology 2020Quote: ... total RNA was isolated from a pool of 5 treated planarians per condition by homogenization in TRIzol Reagent (Invitrogen). Housekeeping gene ura4 was used to normalize the expression levels.
-
bioRxiv - Microbiology 2021Quote: ... 20 µl resuspended parasite culture was incubated with dihydroethidium (5 µg/ml, Cayman) and SYBR Green I dye (0.25 x dilution, Invitrogen) in a final volume of 100 µl medium for 20 min at RT protected from light ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Bioengineering 2022Quote: ... Membranes were probed overnight at 4 °C with primary antibodies diluted to 1/2000 in 5% BSA and 0.1% sodium azide in PBS using specific total MET (#37-0100 Invitrogen), total ERK2 (#SC-154 Tebu-bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×106 TIME cells (passages 14 to 21) were suspended in serum and antibiotic-free DMEM (ThermoFisher, Waltham, MA) and incubated with Halo-CD36 (1 μg ...
-
bioRxiv - Genomics 2022Quote: ... qPCR was performed with gene-specific primer probe fluorogenic exonuclease assays (TaqMan, Life Technologies, Waltham, MA, Supplemental table 5) and the QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2E05 cells of each cell line were resuspended in 200 μL of 5 μM solution of MitoSOX (Invitrogen, UK) prepared in N2B27 media ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated with secondary antibodies conjugated to HRP at 1:20,000 in 5% milk/1x TBST for 1 hour (goat anti-mouse-HRP, 32430; ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were counterstained by 5 min incubation in 300 µM DAPI intermediate solution (1:1,000, Molecular Probes, Cat# B34650). Section were then washed with PBS three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 % PEG400) and 5’ end was phosphorylated by treating RNA with T4 Polynucleotide Kinase (1x PNK buffer (Thermo Scientific), 1mM ATP) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5µl of each peptide extracts were loaded onto 300 µm ID x 5 mm PepMap C18 precolumn (ThermoFisher, Dionex) at 20 µl/min in 2% acetonitrile ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were centrifugated (1000 RPM) and then resuspended in 5 mL of N2B27 with 0.1% of BSA (Life Technologies) and 0.1% of bFgf (PeproTech ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pieces were washed several times in PBS before replacing the solution with 5 ml PBS and 10 mM EDTA pH 8.0 (Invitrogen) and incubating the tissue pieces on ice for 15 minutes with intermittent shaking every 2 minutes ...
-
bioRxiv - Immunology 2022Quote: Small-intestine IELs were isolated as previously described [50] : Changes were made as follow: DTT (BP172-5, Fisher Scientific) was used instead of DTE ...
-
bioRxiv - Genomics 2020Quote: ... Cells were cultured at 37°C in a humidified incubator containing 5% CO2 and maintained in DMEM (Life Technologies) containing 10% FBS (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: HEK293T cells were cultured at 37°C and 5% CO2 in complete medium (Dulbecco’s Modified Eagle Medium, Life Technologies) supplemented with 10% fetal bovine serum (OmegaScientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed in phosphate-buffered saline (PBS) then resuspended in PBS containing 5 μg/mL propidium iodide (Invitrogen). A sample was boiled before resuspension in propidium iodide as a positive control and an unstained sample was used as the negative control ...
-
bioRxiv - Cancer Biology 2019Quote: ... human recombinant Epidermal Growth Factor 1-53 (EGF 1-53, 5 ng/ml, Thermo Fisher Scientific, catalog #17005-042) and 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cultures were maintained at 37°C in 5 % CO2 and 95% humidity in CO2 incubator (Thermo scientific, USA).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: HEK tsA201 cells were maintained at 37 °C and 5% CO2 humidified atmosphere in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (Gibco DMEM/F-12 ...
-
bioRxiv - Zoology 2019Quote: ... Each PCR reaction was run in triplicate and included 5 μl of 2x Platinum Hot Start Master Mix (Invitrogen), 0.5 μl of 10 μM primers ...
-
bioRxiv - Immunology 2019Quote: MCA205 mouse sarcoma cell line is cultured at 37°C under 5% CO2 in RPMI 1640 medium (Life Technologies) in the presence of 1% glutamine ...
-
bioRxiv - Plant Biology 2019Quote: ... with 5 µL of dilution added to 45 µL reaction buffer (40 µL 20 mM sodium phosphate buffer pH 7.5 plus 5 µL 25x Sypro Orange (Invitrogen)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 17.5 μL of this 0.5 mg/ml protein was mixed with 2.5 μL of 8X SYPRO orange (Applied Biosystems) in a final 20 μL reaction volume ...
-
bioRxiv - Cell Biology 2020Quote: ... MV3 and MDA-MB-231 cells were cultured at 37°C and 5% CO2 humidified atmosphere in Dulbecco’s modified Eagle medium (DMEM; Invitrogen), supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Genetics 2020Quote: ... 1μl (equivalent to a 5:1 insert:vector ratio) was ligated into a blunt-ended TOPO vector (Zero Blunt TOPO PCR Cloning Kit, ThermoFisher) and transformed into E.coli ...
-
bioRxiv - Molecular Biology 2019Quote: ... The next morning the decross-linked chromatin was treated with 5 µl of RNAse A/T1 (Thermo Scientific #EN0551) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Microglia-rich fractions enriched by Percoll gradient (described in Section 4.2.2) were stained with CFSE (final concentration 5 μM; Life Technologies) for 20 min at 37 °C ...
-
bioRxiv - Epidemiology 2019Quote: ... The PEK cell line was maintained at 37°C in medium 199 (PIPVE, Russia) supplemented with 5% FBS (Gibco). The suckling mice (FSBI ...
-
bioRxiv - Microbiology 2019Quote: ... Stress response was assessed by measuring glutathione levels using 5-chloromethylfluorescein diacetate (Cell tracker™ green CMFDA, Life Technologies) as already shown in mammalian cells [26,87] and yeasts [23,27] ...
-
bioRxiv - Microbiology 2019Quote: ... and then treated with TryPLE for 5 min at 37°C for cell detachment (catalog number 12563029; Thermo Fisher). The GSC 387 cell line was prepared and maintained similarly to what has been previously described using the media and detachment conditions used for hNSCs described above [29] ...
-
bioRxiv - Cell Biology 2019Quote: ... Sigma#S3139 and Sigma#S9390, 300 mM KCl, Sigma#P9333, 5 mM MgCl2 × 6 H2O, Sigma#M2670, 0.001% Brij35 ThermoFisher, #28316 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The gels were washed with deionised water three times (5 minutes each) and stained with Coomassie blue (SimplyBlueStain, Invitrogen) overnight and destained with deionised water for 4-6 hrs ...
-
A Plant-Specific Polarity Module Establishes Cell Fate Asymmetry in the Arabidopsis Stomatal LineagebioRxiv - Plant Biology 2019Quote: ... GUS transcriptional reporters were generated by cloning 5’ regulatory regions (amplified from genomic DNA) into pENTR D-TOPO (Invitrogen), followed by transfer into the plant binary vector pMDC163 (Curtis and Grossniklaus ...
-
bioRxiv - Biochemistry 2019Quote: ... the pDyn3 plasmid containing the human dynein genes or the pFastBac plasmid containing full-length Lis1 or dynein monomer was transformed into DH10EmBacY chemically competent cells with heat shock at 42°C for 15 seconds followed by incubation at 37°C for 5 hours in S.O.C media (Thermofisher scientific). The cells were then plated on LB-agar plates containing kanamycin (50 μg/ml) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The reaction mix for gene expression assays consists of 5 uL TaqMan Gene Expression Master Mix (Thermo Fisher Scientific), 1x TaqMan gene expression primer ...
-
bioRxiv - Biochemistry 2019Quote: ... Naked templates (200 ng per 1x reaction) were immobilized onto 50 μg /5 μl Dynabeads Streptavidin T1 slurry (Invitrogen) in 1X TE (10 mM Tris-HCl pH 8 ...
-
bioRxiv - Bioengineering 2019Quote: ... Plates were washed twice with PBS/5% FBS and incubated with anti-rat IgG2a (PE) (Thermofisher, 12-4817-82) or anti-histag (PE ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl of yeast cells were added on a poly-L-lysine coated glass slides (Thermo Scientific, Menzel-Gläser) prior to imaging in 3D on an UltraVIEW® VoX spinning disk confocal microscope (Nikon ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Each reaction within multi-plate wells contained 5 μL of TaqMan Universal Master Mix II (Applied Biosystems, Waltham, MA), 2 μL of each sample template and 0.5 μL of each specific plasmid assay in a reaction volume of 10 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... Thiol reactive fluorescent probe IAEDANs (1,5-IAEDANS, 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic Acid) was purchased from ThermoFisher Scientific ...