Labshake search
Citations for Thermo Fisher :
8651 - 8700 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and the wells were overlaid with 4 ml/well DMEM with 5% FBS and 0.7% agarose (Invitrogen, 16500-500). At 6 d.p.i. ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of each culture were spotted onto a TSA plate containing 5% sheep’s blood (Thermo Fisher, R060312). The plates were incubated at 30°C for 72 h and imaged above a white light ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min and labelled with Alexa Fluor 647-conjugated phalloidin (Invitrogen), during 45 min on the dark ...
-
bioRxiv - Microbiology 2021Quote: ... and OAS3 knockout cells were described previously [21] and African green monkey kidney Vero E6 (ATCC CRL-1586) were all maintained at 37°C with 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) (Gibco) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated at 30°C for 45 mins and then stopped by adding 120µl of STOP buffer (0.3 M NaAC, 5 mM EDTA, 0.1% SDS, 40 µg/ml linear acrylamide (Ambion 9520)) and 1 µl of Proteinase K (20mg/ml) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Reverse-phase LC was performed in a trap-and-elute configuration using a trap column (C18 Pepmap100 cartridge, 300 µm i.d. x 5 mm, 5µm; Thermo Scientific) and a C18 analytical column (ChromXP ...
-
bioRxiv - Cancer Biology 2019Quote: ... MCF10A (CRL-10317) cells were cultured in DMEM /F12 Ham’s Mixture supplemented with 5% Equine Serum (Thermofisher Catalog # 16050130), EGF 20 ng/ml (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... entry vectors were recombined with the adenovirus type 5 destination vector pAd5-CMV-V5-DEST using LR Clonase (Invitrogen). pAd5 vectors carrying candidate gene vectors were further sequenced to confirm gene identity ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated with transfection complexes for 5-6 hours and then replated onto #1.5 coverslips (Warner Instruments) coated with Collagen IV (Gibco). Cells were imaged in DMEM/10% FBS ...
-
bioRxiv - Biophysics 2021Quote: ... at 37°C with 5% CO2 MCF-10A cells were cultured in DMEM/F12 medium (PN:11330-032, Invitrogen) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... washed two times and suspended with Williams E medium supplemented with 5 % CCS and 1 mM glutamine (Invitrogen, CA). To separate live from dead cells ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2020Quote: ... The SYBR green qPCR reactions contained 5 µl of 2× Maxima SYBR green/Rox qPCR Master Mix (K0221; ThermoFisher), 5 µl of diluted cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... and HEK293T/17 cells (ATCC, CRL-11268) were grown at 37°C with 5% CO2 in Dulbecco’s modified eagle medium (DMEM, Gibco) supplemented with 10 % heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... animals previously injected with vaccine or PBS where injected 24 hrs before sacrifice in the same footpad with 30 μL of 0.5 mM 5-and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen). For assessing migration after 24 hrs ...
-
bioRxiv - Microbiology 2019Quote: ... VA) cells were cultured at 37°C with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen, Waltham, MA) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: Py-3Y1-S2 rat fibroblast cells were cultured in Dulbecco’s minimum essential medium (DMEM) containing 5% fetal bovine serum (Gibco, Thermo Fisher Scientific K.K. ...
-
bioRxiv - Cell Biology 2020Quote: ... 5×103 BHK cells were plated into each well of a 96 well tissue culture plate (NUNC, cat# 167008). To determine the titer of VSVΔG-AFF-1 ...
-
bioRxiv - Plant Biology 2019Quote: ... urartu was labelled by nick translation with ChromaTide™ Alexa Fluor™ 488-5-dUTP (Invitrogen; C11397; coloured green), 2 ...
-
bioRxiv - Bioengineering 2019Quote: ... was biotinylated using a 5:1 molar excess of Ez-Link™ Sulfo-NHS-LC-Biotin (Thermo-Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% ACN / 0.1% formic acid at a flow of 250 nl/min for 158 min and analyzed with a QExactive Plus mass spectrometer (Thermo Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Genomics 2021Quote: ... we extracted total RNA from rosette leaves of 4-5-week-old plants using Trizol (Invitrogen, cat. No. 15596026) according to manufacturer’s manual ...
-
bioRxiv - Genetics 2020Quote: ... 5-10 μg of backbone was digested using 1 μL Fastdigest Eco31I (aka BsaI, Thermo Fisher Scientific, cat. FD0293) or Fastdigest BpiI (aka Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Genomics 2021Quote: ... were maintained in a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Gibco; 11965092) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were incubated for 1 hour in a solution containing 5% FBS and 1:500 primary antibody (H3K9me3; Invitrogen rabbit polyclonal 49-1008 or H3K9Ac ...
-
bioRxiv - Neuroscience 2020Quote: ... Small aliquots (5 µL) of purified melanopsin was injected into a Fusion Lumos tribrid mass spectrometer system (Thermo Scientific). The HPLC column was a Dionex 15 cm × 75 µm Acclaim Pepmap C18 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples for DNA and RNA analyses were filtered (∼2 to 5 L) through triplicate 0.2 and 0.1 μm filter towers (Thermo Scientific™ Nalgene™ Rapid-Flow™ Sterile Disposable Filter Units with CN Membrane ...
-
bioRxiv - Microbiology 2020Quote: ... pylori was cultured on Trypticase soy agar with 5% (v/v) sheep blood (Thermo Fisher Scientific, Waltham, MA, USA) for 2 days at 37°C in microaerobic conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... buffer B: 0.2% formic acid and 5% DMSO in acetonitrile) in a Dionex Ultimate 3000 LC-system (Thermo Scientific). Peptides were then analyzed using a LTQ Orbitrap Elite mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: MyoD hiPS cells are seeded on 5µg/ml laminin-521-coated (Biolamina) in 5% KSR medium composed of Alpha-MEM (12571-063, Gibco), 5% KSR (10828028 ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 5 and 10ng of cDNA were used in a 4ul reaction using POWEUP SYBR qPCR mix (Life Technologies). All primer-sets were run in technical triplicates ...
-
bioRxiv - Genomics 2021Quote: ... centrifuged at 500xg for 5 minutes at 4°C using a swinging bucket rotor (Sorvall Legend RT, Thermo Fisher), and then pellets were washed with an additional 1 mL cold lysis buffer and incubated on ice for an additional 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Gibco, 11965092; 10% FBS, heat-treated at 56C for 30 minutes, Gibco, 26140079; 5% penicillin-streptomycin 10,000U/mL, Gibco 15140122 ...
-
bioRxiv - Biochemistry 2021Quote: Synthetic genes encoding for human merlin FERM (22-312) and radixin FERM (5-295) domains were commercially synthesized (ThermoFisher) and cloned into pETM33 using NcoI and EcoRI restriction sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both 5 mL and 50 mL tubes were filled with 99.8% molecular grade ethanol (Fisher BioReagents™, Fisher Scientific) and stored in the dark on dry ice during shipment to the University of Otago’s PCR-free eDNA facilities ...
-
bioRxiv - Microbiology 2022Quote: ... Coverslips were washed with 5% FBS and stained with AlexaFluor-488-conjugated goat anti-rat IgG (Invitrogen, 1:500) for 1 h at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were boiled at 95°C for 5 minutes and 15–30μl was separated on Tris-Glycine SDS-PAGE gels (ThermoFisher) followed by Western blotting onto nitrocellulose membranes (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were seeded onto 5 flasks coated with gelatin 5cm2 in F12 medium (Life Technologies, Gibco® 31765-027) with 20% FBS (Dutscher ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were seeded onto 5 flasks coated with gelatin 5cm2 in F12 medium (Life Technologies, Gibco® 31765-027) with 20% FBS (Dutscher ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary AML cell were grown at 37°C with 5% CO2 in Iscove’s Modified Dulbecco’s Media with Glutamax (IMDM, Gibco, Life Technologies) supplemented with 20% fetal calf serum (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% acetonitrile (ACN ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human recombinant epidermal growth factor (Gibco, USA). Cells were maintained in a humidified incubator at 37°C with 5% CO2 level ...
-
bioRxiv - Plant Biology 2021Quote: ... both fragments were independently amplified by PCR and cloned into the intermediate vectors pENTRY 5’ TOPO and pCR8 (Invitrogen), respectively ...
-
bioRxiv - Physiology 2021Quote: ... were plated in plates 1 day before transfection with a total of 2 μg of DNA (1 μg mouse pCMV6-Tmem27-Flag and 1 μg empty vector or pCDNA3.1-BACE2-myc) and 5 μL Lipofectamine 2000 (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... which were boiled for 5 min at 95°C and then separated on 4-12% polyacrylamide gradient gels (Invitrogen). After blotting ...
-
bioRxiv - Biophysics 2021Quote: Superparamagnetic polystyrene beads with a diameter of 1.08 μm (coefficient of variation < 5%, Dynabeads MyOne™ Tosylactivated, 65501, Invitrogen) were functionalized via an amine coupling reaction with 20 μg of anti-digoxigenin Fab fragments (Invitrogen ...