Labshake search
Citations for Thermo Fisher :
7301 - 7350 of 9427 citations for Vertical Gel Casting Cassettes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The plasmids used in the control reactions were generated by segment-specific RT-PCR from clinical samples of B/Victoria and B/Yamagata strains from the 2012-2013 season followed by gel extraction and TOPO-TA cloning (Invitrogen). The sequence of each plasmid was determined by Sanger sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA quality and quantity of the extraction products were checked by electrophoresis on an agarose gel stained with ethidium bromide and using a fluorometric quantitation procedure using a Qubit v.3.0 (Thermo Scientific). The microsatellite genotyping procedure followed the protocol described in Fontaine et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... The successful construction of each plasmid was assessed by double digestion (EcoRI and BamHI) followed by migration on 1% agarose gel stained with SYBR Safe (Invitrogen) and by Sanger sequencing of the region containing the mutation at the Eurofins Genomics sequencing platform ...
-
bioRxiv - Biochemistry 2022Quote: ... Pulldown eluates and input controls were loaded in a 4-12% Bis-Tris gel and ran in NuPAGE MOPS SDS running buffer (Invitrogen) at 200V for 50 min in a XCell SureLock electrophoresis system (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... 10-30 μg of samples was loaded onto NuPAGE 4–12% Bis–Tris Midi Gel (Thermo Fisher Scientific, Cat# WG1403BOX) and electrophoresed with the NuPAGE MOPS SDS running buffer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... The resulting peptides and glycopeptides from each gel region were separately analyzed by LC-MS/MS using a Lumos Tribrid mass spectrometer (ThermoFisher). Proteins identified by peptides detected at <10 spectral matches (PSMs ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 ul of each sample and 3% input of each cell lysate was loaded on a 4-12% Bis-Tris pre-cast SDS-page gel (Invitrogen) and transferred to a PVDF membrane (BioRad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads were collected by centrifugation and the supernatant loaded onto a Novex NuPAGE Bis-Tris 8% gel (Invitrogen, Carlsbad, CA). Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were size confirmed on a 0.1% agarose gel and then sequence confirmed (Eurofins Scientific) after PCR clean up (ChargeSwitch PCR Clean-Up Kit (ThermoFisher Scientific)).
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 μL of boiled beads (representing 4 %) in 1 x NuPAGE loading dye were loaded onto NuPAGE Bis-Tris gels (MW<100 kDa) (Invitrogen) or Tris-Glycine gels (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were run at an increasing voltage (up to 120 V) in NuPAGE 4-12% BisTris gels in 1x MOPS buffer (Invitrogen). Proteins were transferred overnight to a 0.45 µm nitrocellulose membrane at 30 V ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were boiled at 95°C for 5 min before running on a NuPAGE 4-12% Bis-Tris protein gradient mini gel (Invitrogen) at 200 V for 5 min in MOPS running buffer (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the desired 200-600 bp DNA library fragments were selected and isolated using the PureLink DNA gel extraction kit (Invitrogen). Library quality was confirmed using the Agilent 2200 TapeStation nucleic acids system and the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were lysed in RIPA buffer and 20 μg of protein lysate were separated on NuPAGE 4-12% Bis-Tris Midi Gels (Invitrogen). Proteins were transferred onto nitrocellulose membrane and stained with Ponceau Red to confirm complete transfer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were separated on a NuPAGE™ 4–12% Bis-Tris Protein Gel (Thermo Fisher Scientific, Bleiswijk, the Netherlands) and transferred to an Immobilon-FL PVDF membrane (Merck ...
-
bioRxiv - Molecular Biology 2019Quote: The PCR products were purified by gel extraction (cwbiotech, cat#CW2302M) and recombined into vector pDONR221 (Life Technologies, cat#12536017) using Gateway BP Clonase (Life Technologies ...
-
bioRxiv - Biophysics 2022Quote: ... The gel was transferred to the blot chamber (XCell II, EI9051) and blotted on a nitrocellulose membrane (Thermo Scientific, LC2008) for 3h at room-temperature (Blotting buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were boiled at 95 °C for 5 min and separated by SDS–PAGE electrophoresis using 8-16% Tris-Glycine gels (Invitrogen) at 225 V for 30 min ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... Samples were boiled at 95ᵒC for 3 minutes to denature proteins and separated on a 4-12% NuPage Bis-Tris gel (Invitrogen, NP0322BOX). Proteins were transferred using an iBlot Gel Transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Gels were dried under vacuum (80 °C, 120 min.) and exposed to a low-energy phosphor storage screen (Molecular Probes). Protein quantification was performed using ImageQuant TL 8.1 software (GE Healthcare Life Sciences).
-
bioRxiv - Genomics 2020Quote: 20μl of each cellular fraction was used for SDS-PAGE in a NuPAGE 4-12% Bis-TRIS gel and MOPs running buffer (ThermoFisher). For subcellular fraction marker proteins ...
-
bioRxiv - Immunology 2021Quote: Samples were separated on 10 – 20 % SDS-polyacrylamide gels which were incubated with Coomassie (Coomassie brilliant blue R-250, ThermoFisher) for 45 min and subsequently de-stained.
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified products were confirmed on a 1% Agarose gel stained with 4.6μl SYBR safe DNA stain (Invitrogen, Carlsbad, California, USA), and bands at 441 bp were observed in an Ultra Violet gel viewer ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli DY330 genomic DNA (for primers see Table S1) and purified with GeneJET Gel Extraction and DNA cleanup micro kit (PCR cleanup protocol, ThermoFisher). For binding 2.85 pmoles of DNA fragment was mixed with increasing amount of purified EcTopoI (0-16 pmoles and 0-32 pmoles correspondingly ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reactions were denatured in SDS-PAGE sample buffer and resolved in Novex™ 4-20% Tris-Glycine gels (Invitrogen) before immunoblotting with anti-ubiquitin or anti-ubiquitinated protein (clone FK2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol, ThermoFisher). IP for treated aliquot using S9.6 antibodies and nucleic acid purification were performed as described for the untreated aliquot.
-
bioRxiv - Microbiology 2019Quote: ... Expression of recombinant T3E/CT3E-AvrBs262-574-HA proteins was verified by Western blot using the iBlot Gel Transfer Stacks Nitrocellulose kit (Invitrogen), and anti-hemagglutinin (HA)-tag and horseradish peroxidase (HRP ...
-
bioRxiv - Genetics 2019Quote: ... the lysate fraction was run on a NuPAGE 4-12% Bis-Tris gels (Novex) and transferred to PVDF membranes in an iBlot (Invitrogen). Membranes were blocked with 5% milk powder in TBS-T and incubated overnight at 4°C with primary antibodies ...
-
bioRxiv - Cancer Biology 2019Quote: ... The proteins were resolved using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (10%) and then transferred to nitrocellulose membranes (Thermo Fisher). The membranes were first blocked using 5% non-fat milk ...
-
bioRxiv - Developmental Biology 2019Quote: ... equal amounts of otic vesicles or whole brain protein extract were resolved on NuPAGE 4-12% Bis-Tris Gels (Invitrogen) or NuPAGE 3-8% Tris-Acetate Gels (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA quality and concentration were determined by denaturing agarose gel electrophoresis and Qubit RNA BR Assay Kit (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Cancer Biology 2019Quote: Total 20µg of RNA from A375 and A375/211 cells was separated on 15% denaturing polyacrylamide NovexTM TBE urea gel (Invitrogen), blotted on to BrightStarTM-plus positively charged nylon membrane (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The samples were centrifuged at 10,000 x g for 2 minutes and 10 µl portions of the supernatants were loaded on a 4-12% Tris-Glycine slab gel connected to Tris-Glycine SDS running buffer (Invitrogen). The gel was electrophoresed at 200 volts for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... were separated by electrophoresis through 10% (for nuclease knockdown and overexpression experiments) or 15% (for dual reporter experiments) TBE-urea gels (Invitrogen). Following electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... 10-15% of RIPA-soluble fraction and 2.5-5% of insoluble fraction were loaded on 4-12% Bis-Tris gels and run using MOPS buffer (Life Technologies) and visualized by western blotting on PVDF ...
-
bioRxiv - Neuroscience 2019Quote: ... The samples were heated to 95°C for 5 minutes prior to electrophoresis through a 12% Bis-Tris precast gel (Invitrogen), followed by transfer to a nitrocellulose membrane by wet blotting ...
-
bioRxiv - Microbiology 2019Quote: ... LPS samples were resolved on a 12% SDS-PAGE gel and stained with the Pro-Q Emerald 300 LPS stain kit according to the manufacturer’s protocol (Thermo Scientific). Images were acquired on a Bio-Rad ChemiDoc MP using UV excitation and a 530 nm emission filter.
-
bioRxiv - Molecular Biology 2019Quote: ... of each sample and 100 ng of yeast tRNA mix as control were separated on NOVEX TBE-Urea Gels 10% (Invitrogen), transferred to Nylon Hybond N+ membranes (Amersham ...
-
bioRxiv - Biochemistry 2019Quote: ... DNA was extracted by phenol/phenol chloroform extraction and ran on a 10% Novex TBE + urea gel (Invitrogen cat #EC6875BOX). The gel was post-stained with Syto 60 (Invitrogen cat #S11342 ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by a digestion with the Nuclease and Enhancer proteins at 42°C before being electrophoresed on a 10% TBE Gel (Thermofisher). The gel was then stained in 100 ml 1x TBE buffer with 2 μl of 10 mg/ml ethidium bromide for 5 min ...
-
bioRxiv - Neuroscience 2019Quote: ... 14μl of this mixture was then loaded onto precast 15 well Novex TBE 20% gel (Thermo Fisher Scientific, Waltham, MA) using a 25µL Hamilton Syringe ...
-
bioRxiv - Biophysics 2019Quote: ... Reactions were incubated and processed as described above except that the percentage of protein gels used was 12% Bis-Tris (Invitrogen).
-
bioRxiv - Genomics 2019Quote: ... The samples were cooled down to RT before loading them on a 3-8% Tris-Acetate Protein Gels (Invitrogen EA0375PK2). Next ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were lysed with RIPA-2 buffer and run out on 7.5% SDS-PAGE gels followed by rapid transfer on iBlot2 (Thermo Fisher). Changes in electrophoretic mobility were assessed via immunoblotting with FLAG (Sigma F3165) ...
-
bioRxiv - Microbiology 2019Quote: ... Quality of the DNA was checked on 0.8% agarose gel and DNA was quantified using Qubit Fluorometer (Thermofisher Scientific, USA), with a detection limit of 10-100ngμL-1.
-
bioRxiv - Microbiology 2019Quote: ... Samples were heated in Laemmli buffer at 100°C for 5min before proteins were separated on gradient polyacrylamide gels (4-12%, NuPage, Invitrogen), which were run at 175V for 50min ...
-
bioRxiv - Bioengineering 2019Quote: ... denaturing gels were run with 6 μL per well of a 1:1 mixture of sample and Gel Loading Buffer II with formamide (Ambion) in a 10% TBE-Urea ...
-
bioRxiv - Microbiology 2019Quote: ... RNA fragments between 20 and 40 bp were isolated by size excision from a denaturing polyacrylamide gel (15%, TBE-Urea, 65 min., 200 V, ThermoFisher). RNA fragments were dephosphorylated using T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were separated on a precast 4-12%Bis-Tris Plus gel in Bolt™ MOPS SDS running buffer (Invitrogen). Gels were blotted on a Nitrocellulose membrane (Amersham TM Protran™ 0.45um ...