Labshake search
Citations for Thermo Fisher :
7101 - 7150 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Organoid cultures established from human ACCs were dissociated from Matrigel by incubation with a solution of 2 mg/mL Dispase-II (Thermo Fisher, 17105041) and 200 U/mL Collagenase-III (Worthington ...
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Systems Biology 2022Quote: Adult human epidermal keratinocytes were cultured in EpiLife serum-free keratinocyte growth medium supplemented with Human Keratinocyte Growth Supplement (HKGS) and 100 units/mL Penicillin and 100 μg/mL Streptomycin (Thermo Fisher Scientific). Adult human dermal fibroblasts were cultured in Medium 106 supplemented with Low Serum Growth Supplement (LSGS ...
-
bioRxiv - Neuroscience 2022Quote: The expression level of 752 miRNAs was screened by real-time PCR with TaqMan Advanced miRNA Human A and B Cards (Applied Biosystems A31805). cDNAs were diluted 1:10 with 0.1X TE buffer ...
-
bioRxiv - Microbiology 2022Quote: ... ATCC TIB-202) or primary human monocytes (PHMs) were propagated in RPMI 1640 with L-glutamine and 25 mM HEPES buffer (Invitrogen, Carlsbad, CA), supplemented with 1 mM sodium pyruvate (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: Raw MS Data were searched against the human SwissProt protein database (Version November 2020) with Proteome Discoverer 2.4 (ThermoFisher Scientific, Bremen, Germany) using the following parameters ...
-
bioRxiv - Developmental Biology 2022Quote: Culture media consisted of LWRN conditioned media generated as previously described45,46 and combined with human basal media (Advanced DMEM/F12 (Gibco, Cat#12634-028); Glutamax 4 mM (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... Immune mediator levels in COVID-19 patient plasma across different active and convalescent groups were measured with 24-plex Human ProcartaPlex™ (ThermoFisher Scientific). The kit analyte detection panel included brain-derived neurotrophic factor (BDNF) ...
-
bioRxiv - Microbiology 2021Quote: ... plates were washed three times and incubated for 30 minutes at room temperature with cross-absorbed goat anti-human IgG-horseradish peroxidase (HRP)-conjugated secondary antibody (ThermoFisher Scientific; A18811) diluted to a 1:2500 dilution in ELISA wash buffer ...
-
bioRxiv - Microbiology 2020Quote: ... containing 10 μg/ml DNase I (StemCell; #7469) and re-plated into 12-well plates coated with 10 μg/ml human bulk fibronectin (ThermoFisher Scientific; #3560) at a density of 750,000 cells/well ...
-
bioRxiv - Neuroscience 2020Quote: Human HGSNAT codon-optimized cDNA Tordo (31) fused to a GFP (HGSNAT-GFP) was cloned into a pENTR1A vector (Invitrogen, 11813-011) and then transferred to a 3rd generation lentiviral vector plasmid (pLenti PGK Blast DEST (w524-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Commercially available ELISAs for quantitative detection of human total IgG were used according to manufacturer’s protocols (Thermo Fisher Scientific, Waltham, MA, U.S.A.). All plates were read in a microtiter plate reader at 450 nm and optical density values were used in statistical analyses.
-
bioRxiv - Cell Biology 2020Quote: ... 0.055 mM β-mercaptoethanol (#21985-023) and recombinant human full-length bFGF (#PHG0261) at 10 ng/ml (all reagents from Life Technologies).
-
bioRxiv - Microbiology 2021Quote: ... followed by one wash in a large volume of PBS and then incubation with Alexa647-coupled anti-human secondary antibody (Thermo Fisher Scientific) at 1:200 in 10% FCS in PBS ...
-
bioRxiv - Biochemistry 2020Quote: hTERT keratinocytes were cultured with Epilife media supplemented with human Keratinocyte Growth Supplement and Gentamicin/Amphotericin B 500X (Thermo Fisher Scientific, USA). Cells grown to passage 3 were treated for 24 hr with vehicle (DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... They were then incubated with 1:200 diluted Alexa Fluor 594 conjugated goat anti-human IgG secondary antibody (Invitrogen, Thermo Fisher Scientific) for 45 min at RT and subjected to flow cytometric analysis with a CytoFLEX flow cytometer (Beckman) ...
-
bioRxiv - Microbiology 2020Quote: ... and cultured in RPMI medium supplemented with 10% FBS and differentiated for 7 days with 20 ng/mL recombinant human Macrophage-Colony Stimulating Factor protein (M-CSF) (Thermo Fisher Scientific), and 100U/L of penicillin-streptomycin solution (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted and the whole transcriptome of ALDH+ and ALDH-populations was assessed using Affymetrix Whole-Transcript Human Gene 1.0 ST Array (Affymetrix, Thermo Fisher Scientific) (30) ...
-
bioRxiv - Bioengineering 2021Quote: ... Recovered nanovials were washed two times with washing buffer and sequentially labeled with streptavidin and biotin goat anti-human IgG Fc (Thermo Fisher, A18821) following standard procedures described above ...
-
bioRxiv - Cancer Biology 2021Quote: ... together with 0.5µg of a plasmid expressing the renilla luciferase under the control of the human β-actin promoter using Lipofectamine 3000 (ThermoFisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Human VAT and SAT biopsies (30-50g) were minced and digested with 3mg/mL type II collagenase solution (ThermoFisher Scientific Inc./Gibco) in HBSS containing calcium chloride ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum B11 line (Perrin et al., 2018) was maintained at 37° C in human RBCs in RPMI 1640 containing Albumax II (Thermo Fisher Scientific) supplemented with 2 mM L-glutamine ...
-
bioRxiv - Immunology 2022Quote: A human primary fibroblast line was maintained in Dulbecco’s Modified Eagle’s Medium with 10% heat inactivated FBS (Thermo Fisher Scientific, Gothenberg, Sweden), 10 U/ml Penicillin/Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... arrays were incubated for 1h30 with AF647-conjugated goat anti-human IgG antibodies (at 1 µg/ml in PBS; Thermo Fisher Scientific), and revealed using GenePix 4000B microarray scanner (Molecular Devices ...
-
bioRxiv - Cancer Biology 2022Quote: ... These plasma samples were diluted at least 2x or more (as required) and then were used to detect PTN by ELISA using commercial human PTN ELISA kits (ThermoFisher Scientific, EH370RB). CXCL5 ELISA from tumor lysates was performed using commercial kit (R&D Systems ...
-
bioRxiv - Microbiology 2022Quote: ... 99 base pair DNA sequences from genes selected for validation were amplified from human RNA using SuperScript IV One-STEP RT-PCR (Thermo Fisher Scientific), or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... The internalization of the ACE2-HA protein and anti-hACE2 mAbs was then evaluated by staining with goat anti-mouse Alexa Fluor™ 594 (to detect the HA-tagged hACE2) and/or goat anti-human Alexa Fluor™ 488 antibodies (to detect the hACE2 mAbs) (ThermoFisher Scientific). Images were captured using a DeltaVision OMX SR imaging system (GE Healthcare).
-
bioRxiv - Systems Biology 2020Quote: We cultured GM11169 human cardiac fibroblasts (Coriell, GM11169; XX donor) on tissue culture-treated dishes in DMEM w/Glutamax + 9% FBS (Life Technologies 16000044) + P/S.
-
bioRxiv - Molecular Biology 2019Quote: ... the miRIDIAN microRNA Mimic (catalog number CS-001030) and Inhibitor (catalog number IH-001030) Libraries (19.0, human microRNAs) were purchased from Dharmacon (Thermo Fisher Scientific Inc.). For the mimic screen ...
-
bioRxiv - Cancer Biology 2019Quote: ... labeled cDNA targets were generated with the Encore® Biotin Module (Nugen) and hybridized to a GeneChip® Human Transcriptome Array 2.0 (Affymetrix, Thermo Fisher) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cells were cultured for 14 days in a humified CO2 incubator at 37°C in complete culture medium with Dynabeads® Human T-Activator CD3/CD28 beads (ThermoFisher Scientific) (25µl/well ...
-
bioRxiv - Immunology 2019Quote: ... a 20X IL-26 human TaqMan® probe was used (Hs00218189_m1) with 2X TaqMan® Fast Advanced Master Mix (both from ThermoFisher Scientific). OSM and HEBGF cDNA quantification was performed with Roche ® hydrolysis probes (OSM ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA from human cytobrushes was also reverse transcribed to first strand cDNA using the SuperScript™ IV VILO™ Master Mix (11766050, Invitrogen). To quantify host inflammatory mediators’ transcripts (IL-6 ...
-
bioRxiv - Microbiology 2021Quote: Primary HFFF immortalised with human telomerase (HFFF-TERTs) (96) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific, Lutterworth, UK) supplemented with 10 % foetal bovine serum (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells in 35-mm dishes were transfected with 100 pmol of each siRNA in the Stealth siRNA library targeting 154 human nuclear proteins (Invitrogen–Thermo Fisher Scientific) using Lipofectamine RNAiMax (Invitrogen–Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mouse lung fibroblasts (CCL-206, ATCC, Wesel, Germany) or human lung fibroblasts (MRC5, ATCC, CCL-171) were cultured in 1:1 DMEM (Gibco, MD, USA) and Ham’s F12 (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were washed three times with PBS and then incubated with either goat anti-human IgG conjugated with Alexa fluor 488 at a dilution of 1:500 for 1 h (Invitrogen, Carlsbad, CA). The cells were then washed and stained with hoechest-33342 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: RNA was extracted from pulverized left or right ventricle human cardiac tissue using the mixVana miRNA isolation kit (Thermo Fisher Scientific, #AM1560), according to the manufacturer’s specifications ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... All coding exonic and flanking intronic regions of the human TP53 gene were amplified from genomic DNA with Platinum™ Taq DNA polymerase (Life Technologies) by multiplex PCR using two primer pools with 12 non-overlapping primer pairs each ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were transfected with 2.5 µM ON-TARGET plus human SAMHD1 siRNA SMART-pool obtained from Dharmacon (Munich, Germany, L-013950-01-0050) in resuspension electroporation buffer R (Invitrogen, Dreieich, Germany) using the Neon transfection system (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Insertion of single base pair changes for the generation of human and mouse FOXN1 variants was achieved by site-directed mutagenesis using the Phusion site-directed mutagenesis kit (Thermo Fisher Scientific).Specific primers for the introduction of single base pair deletions or single base pair changes were designed using the following software www.agilent.com/store/primerDesignProgram.jsp ...
-
bioRxiv - Immunology 2020Quote: ... Anti-IgE beads were created for use in the LIPS assay by coupling goat anti-human IgE (SeraCare KPL, Gaithersburg, MD) to Ultralink beads (ThermoFisher, Waltham, MA).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... was performed using Taqman reagents and specific primer and probe sets for human SLC22A24 (Assay ID: Hs00543210_m) and GAPDH (Assay ID: Hs99999905_m1) (Applied Biosystems, Foster City, CA). Reactions were performed in a 96-well plate with a 10 µL reaction volume using an ABI 7900HT Fast Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... operated by UNICORN software version 5.11 (Build 407) using HiTrap Protein A columns (Cytiva) for full length human mAbs and CaptureSelect CH1-XL MiniChrom columns (Thermo Fisher Scientific) for Fab fragments ...
-
bioRxiv - Microbiology 2020Quote: ... They were then incubated with 1:200 diluted Alexa Fluor 594 conjugated goat anti-human IgG secondary antibody (Invitrogen, Thermo Fisher Scientific) for 45 min at RT and subjected to flow cytometric analysis with a CytoFLEX flow cytometer (Beckman) ...
-
bioRxiv - Neuroscience 2021Quote: hiPSCs were previously generated from healthy adult human dermal fibroblast lines from a 32-year-old female from Invitrogen (C-013-5C), as described before (31) ...
-
bioRxiv - Biophysics 2021Quote: ... This step was performed in order to break the existing cadherin junctions and allow the blocking antibodies (anti N-Cadherin antibody: LEAF™ Purified anti-human CD325, #350804, Biolegend, USA; anti E-Cadherin antibody: CD324 #16-3249-82, Invitrogen, USA) to bind to their respective epitopes ...
-
bioRxiv - Cell Biology 2021Quote: ... AlexaFluor488-labeled human transferrin was dissolved in PBS 5 at mg/ml and stored at 4°C (Thermo Fisher, ref. no. 13342). TexasRed-labelled neutral 3’000 and 40’000 Da dextran was dissolved in PBS at 10 mg/ml and stored at -20°C (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA deriving from LCM human pancreatic islets was then amplified using TaqMan PreAmp Master Mix (cat. 4488593, ThermoFisher Scientific, Waltham, MA, USA) following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... 150 ng of labelled probe was combined with 5 μg salmon sperm and 10 μg human C0t1 DNA (Invitrogen, Cat No 15279011). Two volumes of ethanol were added and the probe mix was collected by centrifugation and dried ...