Labshake search
Citations for Thermo Fisher :
7201 - 7250 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... cells were surface stained with cell-viability dye (Fixable Blue dead cell stain kit, Invitrogen), followed by anti-CD3-BV711 (BioLegend) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell proliferation was performed by live cells staining with alamarBlue cell viability reagent (Invitrogen #DAL1100) at 6 ...
-
bioRxiv - Bioengineering 2024Quote: ... monolayer Cells and cell aggregates were dissociated into single cells using TryPLE Express Enzyme (Gibco) at 37°C for 3-5 minutes (monolayer ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated with 5 µM of Cell Trace Violet Cell Proliferation Kit (C34557; ThermoFisher), incubated for 10 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... cells were then washed 3 times with PBS and incubated with goat anti-rabbit Alexa Fluor 488 or goat anti-human Alexa Fluor 488 secondary antibodies (Thermo Fisher Scientific) for 1h at RT ...
-
bioRxiv - Biophysics 2021Quote: ... Cultured cells were stained with mAb 0614 or human chimera MAb 0614-5 as the primary antibody and Alexa Fluor 488– or 647–conjugated anti-rat or human-Ig polyclonal antibody (Thermo Fisher Scientific) as the secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... and on the surface of H1568 EVs (with IFN-γ stimulation) were quantified using a PD-L1 Human ELISA kit (#BMS2212, ThermoFisher Scientific). For the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a human IL-6 siRNA pool (Horizon Discovery, LQ-007993-00-0005) were transfected using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen, 13778) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... containing 500 μm disk patterns were coated with 10 μg/ml recombinant human laminin 521 (BioLamina) diluted in pre-warmed DPBS (Thermo Fisher Scientific) for 3 hours at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA samples from affected individuals and unaffected family members were subjected to WES using Agilent SureSelect™ human exome capture arrays (Life Technologies) with next generation sequencing (NGS ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were immunostained according to standard protocols [21] using a primary rabbit anti-human antibody directed against zona occludens-1 (ZO-1; 1:100, Thermo-Fisher Scientific, UK) and a AF488-conjugated secondary goat anti-rabbit antibody (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... 200,000 cells were transfected in 12 well plate with 25 pmol siRNA (siTFEB : ON-TARGETplus Human TFEB, L-009798-00-0005, Dharmacon™) using Lipofectamine RNAiMAX Transfection Reagent (1:200; Life Technologies). Cells were incubated 72 h at 37°C prior to further manipulation or drug treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then incubated with Alexa 594 goat-anti rabbit secondary antibody at 1:750 and with Alexa Fluor 488 goat anti-human IgG(H+L) at 1:500 (both Invitrogen; in PBS) for 2 h at RT.
-
bioRxiv - Neuroscience 2021Quote: ... cRNA transcripts encoding human KCNQ1-5 were generated by in vitro transcription using the T7 polymerase mMessage mMachine kit (Thermo Fisher Scientific) or SP6 polymerase mMessage mMachine kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and cultured in 10% human AB serum (produced in house) and 100 U/mL penicillin and 100 µg/mL streptomycin (Thermo Fisher Scientific) supplemented RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Immortalized primary human fibroblasts (gift from Paola Scaffidi) expressing human telomere reverse transcriptase (hTERT) (Scaffidi and Misteli, 2011) were grown in MEM (Thermofisher, 11095-080) supplemented with 15% FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Media were collected after 24h in culture and cytokine/chemokine concentrations analyzed using the Inflammation 20-Plex Human ProcartaPlex™ panel (EPX200-12185-901, Thermo Fisher) following the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: ... SEMA3C protein levels were checked by western blot as described above using rabbit anti-human SEMA3C antibody (1:1000, Thermo Fisher Scientific). Beta-actin (housekeeping gene ...
-
bioRxiv - Immunology 2021Quote: ... or unseparated PBMCs (1 × 105 per well) were stimulated for 48-72 hours either with Dynabeads™ Human T Activator CD3/CD28 antibody coated beads (Thermo Fisher) at 2:1 or 4:1 bead:cells ratios or with plate-bound anti-CD3 and soluble anti-CD28 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Colorimetric protein assays were conducted using commercial human IL-8 ELISA and mouse IL-6 ELISA kits (Invitrogen; 88-8086, 88-7064) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs were dissociated with TrypLE Express for 5 mins at 37°C and induced into EpiLCs by addition of human recombinant basic fibroblast growth factor (bFGF) (Invitrogen, 13256-029) and activin A (Peprotech ...
-
bioRxiv - Immunology 2021Quote: ... and searched against the UniProt Human protein database and RefSeq SARS-CoV-2 protein database using Sequest HT through Proteome Discoverer (Version 2.2) (Thermo Scientific, Bremen, Germany). Precursor and fragment mass tolerance were set to 10 ppm and 0.02 Da ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary human dermal fibroblasts were collected from VWMD patients (2) or control family members (2) and maintained in DMEM/F12 (Life Technologies, 21331020), 10% FBS (Bovogen ...
-
bioRxiv - Cell Biology 2020Quote: ... human S1R gene was amplified by PCR and cloned into pFastBac-HTA vector (Bac-to-Bac baculovirus expression system, Thermo Fisher Scientific) using EcoRI/HindIII sites ...
-
bioRxiv - Cell Biology 2020Quote: ... staining (outside human-marked tissue) or by immunostaining with fluorescently-conjugated wheat germ agglutinin (WGA alexafluor-647, W32466, 1:500, Thermo Fisher Scientific). Specifically ...
-
bioRxiv - Bioengineering 2021Quote: ... A 2kb region surrounding the TRAC locus was amplified by PCR from human genomic DNA and cloned into a pCR blunt II TOPO backbone (Thermo Fisher Scientific). The CAR transgene from a pSFG.iCasp9.2A.14G2A-CD28-OX40-CD3ζ RV-CAR plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... Phages displaying human Fabs were enriched after three rounds of biopanning on biotinylated recombinant human ACE2 immobilised to streptavidin Dynabeads (Dynal M-280, Invitrogen, cat # 112.06D). After the third round of panning ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: Human wild-type (WT) alpha-synuclein was expressed in Escherichia coli One Shot® BL21 STAR™ (DE3) (Invitrogen, Thermo Fisher Scientific) cells using plasmid pT7-7 and purified using ion-exchange on a HiPrep Q FF 16/10 anion exchange column (GE Healthcare ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: Human wild-type (WT) alpha-synuclein was expressed in Escherichia coli One Shot® BL21 STAR™ (DE3) (Invitrogen, Thermo Fisher Scientific) cells using plasmid pT7-7 and purified using ion-exchange on a HiPrep Q FF 16/10 anion exchange column (GE Healthcare ...
-
bioRxiv - Bioengineering 2021Quote: ... episomally derived from human foreskin fibroblasts) was cultured on tissue culture-treated plasticware pre-coated with 1mL per well Geltrex (Life Technologies A1413302) for 1 hour at 37C ...
-
bioRxiv - Systems Biology 2021Quote: ... 400 ng of the constructed plasmids containing the human gene transcriptional units (Table S9D) were linearized by digestion with NotI (FastDigest, Thermo Fisher Scientific) according to the manufacturer’s protocol for 30 min and subsequently the digestion mix was directly transformed to IMX1076 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Supernatant was harvested at the indicated timepoints and IL-2 levels in the supernatant were measured via IL-2 Human Instant ELISA kit (Thermo Fisher #BMS221INST). T-cell proliferation was also measured at the indicated timepoints using a BD FACSymphony Fortessa X-50.
-
bioRxiv - Microbiology 2021Quote: Characterization of the immune response via bead-based determination of cytokine and chemokine concentrations was performed using a Life Technologies Cytokine 37-plex Non-Human Primate Panel for Luminex platform (#EPX370-40045-901, Thermo Scientific, USA) according to manufacturer instructions in BSL-2+ conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed using TaqMan gene expression assays (Human-Assay ID Hs00917510_m1; and (Rat-Assay ID Rn01489483_m1; Applied Biosystems, Life Technologies, Carlsbad, CA). Gene expression was quantified by the comparative Ct value ...
-
bioRxiv - Cell Biology 2021Quote: ... A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat#: A35526). The deletion efficiency of HIF-1α and syndecan-1 proteins was measured by western blot and flow cytometry ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from 100 mg of human prefrontal tissues using the TRIzol reagent (Thermo Fisher Scientific, Inc. Waltham, MA, USA), as described by the manufacturer ...
-
bioRxiv - Biophysics 2021Quote: ... After washing thrice with PBS-0.1% Tween 20 the membrane was probed with primary antibody which is a rabbit monoclonal anti human lamin A+C antibody (Thermo Scientific, USA) and Stabilized Peroxidase Conjugated secondary Goat Anti-Rabbit (H+L ...
-
bioRxiv - Biophysics 2020Quote: The plasmid pET3a containing human AβM42 and AβMC40 cDNA was transformed into Escherichia coli (E. coli) One Shot® BL21 (DE3) pLysS (Thermo Fisher Scientific, USA). The plasmids were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were pulsed in starvation buffer supplemented with 0.1% w/v bovine serum albumin at 4 °C for 40 min with 50 ng/mL human recombinant EGF (Thermo-Fisher, Gibco™, PHG0311L) to allow ligand bind to the EGFR ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% human AB serum (produced in house) and 100 U/mL penicillin and 100 µg/mL streptomycin (Thermo Fisher Scientific). Mixed PBMCs were plated at densities of 600,000 cells per 200 µL and per well of 96-well u-bottom shape plates (Corning ...
-
bioRxiv - Cancer Biology 2022Quote: ... The blots were incubated separately either with mouse monoclonal anti-human CD44 (156-3C11) antibody (Cat# MA513890, ThermoFisher Scientific, Waltham, MA, USA), mouse monoclonal anti-human CD63 antibody (Cat# ab8219 ...
-
bioRxiv - Genetics 2022Quote: BJ cells were transfected with 60nM of human siRNA for different timings (indicated in the main text for each experiment) using Lipofectamine RNAiMax reagent (Invitrogen, 13778-075) and Opti-MEM medium (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: Organoid cultures established from human ACCs were dissociated from Matrigel by incubation with a solution of 2 mg/mL Dispase-II (Thermo Fisher, 17105041) and 200 U/mL Collagenase-III (Worthington ...
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Systems Biology 2022Quote: Adult human epidermal keratinocytes were cultured in EpiLife serum-free keratinocyte growth medium supplemented with Human Keratinocyte Growth Supplement (HKGS) and 100 units/mL Penicillin and 100 μg/mL Streptomycin (Thermo Fisher Scientific). Adult human dermal fibroblasts were cultured in Medium 106 supplemented with Low Serum Growth Supplement (LSGS ...
-
bioRxiv - Neuroscience 2022Quote: The expression level of 752 miRNAs was screened by real-time PCR with TaqMan Advanced miRNA Human A and B Cards (Applied Biosystems A31805). cDNAs were diluted 1:10 with 0.1X TE buffer ...
-
bioRxiv - Microbiology 2022Quote: ... ATCC TIB-202) or primary human monocytes (PHMs) were propagated in RPMI 1640 with L-glutamine and 25 mM HEPES buffer (Invitrogen, Carlsbad, CA), supplemented with 1 mM sodium pyruvate (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: Raw MS Data were searched against the human SwissProt protein database (Version November 2020) with Proteome Discoverer 2.4 (ThermoFisher Scientific, Bremen, Germany) using the following parameters ...
-
bioRxiv - Developmental Biology 2022Quote: Culture media consisted of LWRN conditioned media generated as previously described45,46 and combined with human basal media (Advanced DMEM/F12 (Gibco, Cat#12634-028); Glutamax 4 mM (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... Immune mediator levels in COVID-19 patient plasma across different active and convalescent groups were measured with 24-plex Human ProcartaPlex™ (ThermoFisher Scientific). The kit analyte detection panel included brain-derived neurotrophic factor (BDNF) ...