Labshake search
Citations for Applied Biological Materials :
401 - 450 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... agent-based model (ABM) incorporates cluster size dynamics ...
-
bioRxiv - Cancer Biology 2021Quote: ... and titered using lentivirus qPCR titer kit (ABM). 1963B and BT20 cells were transduced with the virus at an MOI of 10 following puromycin selection (2 ug/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... the RNA extraction was probed with or without RNase R (Applied Biological Materials Inc., Vancouver, Canada) at 37□ for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and pLenti-III-miR-GFP Control Vector (Cat: M001, Applied Biological Materials) were purified using the EndoFree Plasmid Maxi Prep Kit (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... the LentimiRa-GFP-hsa-miR-494-3p Vector (Cat: mh10739, Applied Biological Materials, abmgood.com) and pLenti-III-miR-GFP Control Vector (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa and RPE1 cells were tested and found negative for mycoplasma using a PCR mycoplasma detection kit (ABM, Bellingham, WA). Cell types were authenticated by sequencing 24 loci (University of Utah Sequencing Core).
-
bioRxiv - Cell Biology 2020Quote: ... 156 GGGAGAAGTTATACACTGGC and 350 AGTTTCGTGAGCGGATAGAA (Applied Biological Materials), and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology) ...
-
bioRxiv - Cell Biology 2020Quote: ... c2MPs cells were transfected by empty pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro (Applied Biological Materials). See Supplemental Materials and Methods for detailed protocol.
-
bioRxiv - Cell Biology 2020Quote: Stably Cas9-expressing HepG2 cells were transduced at a multiplicity of infection (MOI) of 1.5 with lentivirus containing a sgRNA targeting human LDLR (ABM Goods, Inc. Canada, Cat# 264181110204) and a neomycin selection marker ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA purification and reverse transcription were performed as previously described.[27] qPCR master-mix (Applied Biological Materials Inc., Canada) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg RNA was used for cDNA synthesis by Oligo(dT)-primed reverse transcription using the OneScript Reverse Transcriptase kit (ABM, Canada). Real-time quantitative PCR was performed to analyze the gene expression levels ...
-
bioRxiv - Plant Biology 2020Quote: ... RNAs were then reverse transcribed into cDNAs by OneScript Reverse Transcriptase (Applied Biological Materials Inc.). qPCR was performed with cDNAs using SYBR Premix Ex Taq™ II (Takara ...
-
bioRxiv - Microbiology 2020Quote: The OneScript Reverse Transcriptase cDNA Synthesis kit by Applied Biological Materials Inc ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 µL ViralPlus Transduction Enhancer (Applied Biological Materials Inc., G698) and 40 µL concentrated lentivirus and cultured overnight (Day 1) ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2020Quote: RNA sequencing was performed by Applied Biological Materials Inc (Canada) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and dCas9 recombinant protein (Applied Biological Materials Inc.). After 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1205Lu melanoma cells stabling expressing GFP (Applied Biological Materials) were transfected with lentivirus carrying negative control shRNA (1205Lu-shNC ...
-
bioRxiv - Cancer Biology 2020Quote: 1205Lu cells were transfected with FADS2 targeting shRNA lentiviral particles (Applied Biological Materials, shFADS2 #1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRI (0.05 µg/ul) was obtained from ABM (Z500115). Heme (Frontier Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Resist-coated silicon wafers were patterned with circles (Diameter: 1 µm; Center-to-center spacing: 2 µm) using 220 nm deep UV lithography (ABM, USA). Then ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Evolutionary Biology 2020Quote: For the agent based model (ABM) simulations ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... where the distributions from ABM simulations for M = 2 (red circles ...
-
bioRxiv - Bioengineering 2020Quote: ... Human SV40-immortalized microglia are purchased from Applied Biological Materials, Inc and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA was prepared from total RNA using the 5XAll-in-One MasterMix (with AccuRT Genomic DNA Removal Kit) (ABM, China). Levels of target genes were determined by Roche LightCycler 96 Real Time PCR Detection System with SYBR Green qPCR Master Mix (Biomake) ...
-
bioRxiv - Microbiology 2020Quote: ... One μg of total RNA was used to synthesize cDNA using 5XAll-in-One MasterMix (AccuRT Genomic DNA Removal Kit, ABM, Shanghai, China). The cDNA was used as template in qPCRs with primers Asafor /Asarev ...
-
bioRxiv - Bioengineering 2020Quote: ... and anti-beta-actin (G043, ABM) were used for detecting endogenous TAGLN2 proteins ...
-
bioRxiv - Biochemistry 2020Quote: ... Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... The human microglia (hMG) cell line was purchased from Applied Biological Materials (ABM). Mouse glioblastoma cell GL261 was generously provided by Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell line was purchased from Applied Biological Materials (ABM). Mouse glioblastoma cell GL261 was generously provided by Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... Flag (G191 ABM and F7425 Sigma), GFP (A6455 Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Flag (G191 ABM and F7425 Sigma), GAPDH (14C10 Cell Signaling) ...
-
bioRxiv - Physiology 2020Quote: ... The cDNA was prepared from total RNA (50-100ng) with ABM 5x All-In-One RT Master Mix (G486, Applied Biological Materials Inc.). The cDNAs of SENP1 and cyclophilin A were amplified using preamplification primers and Platinum Taq DNA polymerase (10966-018 ...
-
bioRxiv - Biochemistry 2020Quote: HEK293 Expressing Rpn11-HTBH (Applied Biological Materials, T6007)
-
bioRxiv - Systems Biology 2020Quote: We model constricted cell migration using an on-lattice two-dimensional (2D) agent-based model (ABM) system ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR was performed using the EvaGreen qPCR Mastermix (Applied Biological Materials, BC, Canada), and the results were normalized to the signals of GAPDH expression ...
-
bioRxiv - Neuroscience 2020Quote: High titers (>1012 gc/mL) of AAV1 viral particles containing Tet1 isoform TALE constructs were packaged by Applied Biological Materials (ABM). For primary hippocampal neuron experiments in 12 or 24 well plates ...
-
bioRxiv - Neuroscience 2020Quote: ... or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., Richmond, BC, Canada). Viral titers were 1.425 x 109 GC/mL for lacZ sgRNA control ...
-
bioRxiv - Neuroscience 2020Quote: ... The complex memory task consisted of randomly interleaved blocks of autobiographical memory (ABM) retrieval trials and working memory (WM ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were tested for mycoplasma contamination before use and at regular intervals during experimentation (ABM, catalogue no. G238).
-
bioRxiv - Neuroscience 2020Quote: ... were cultured in astrocyte basal medium (ABM) supplemented with AGM™ BulletKits™ (Lonza ...
-
bioRxiv - Plant Biology 2020Quote: ... two volumes of SPRI (Solid Phase Reversible Immobilization) magnetic beads (Applied Biological Materials, Richmond, BC, Canada) were added to the amplified RT-RPA products ...
-
bioRxiv - Microbiology 2020Quote: We used an agent-based model (ABM) developed to trace the ongoing COVID-19 pandemic in Australia40 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Verification of cell lines was performed by Short Tandem Repeat (STR) DNA profiling (Applied Biological Materials Inc, Canada).
-
bioRxiv - Cell Biology 2020Quote: Stably Cas9-expressing HepG2 cells (ABM Goods, Canada; Cat# T3256) were cultured in growing media ...
-
bioRxiv - Cell Biology 2020Quote: ... lentiviral sgRNA targeting human LDLR (Cat# 264181110204) and non-viral plasmids containing sgRNA targeting individual candidate genes were purchased from ABM Goods ...