Labshake search
Citations for Applied Biological Materials :
301 - 350 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... or scrambled siRNA GFP lentivector (Applied Biological Materials, catalog #: LV015-G) together with psPAX2 and pMD2.G plasmids using TransIT-2020 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human HC cells immortalized by human telomerase reverse transcriptase (hTERT) expression were purchased from Applied Biological Materials (cat. no. T0570). The cell lines used were not further authenticated ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with a Hsp47-set of four siRNA lentivectors (rat) (Applied Biological Materials, catalog #: 435050960395), or scrambled siRNA GFP lentivector (Applied Biological Materials ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentivirus was quantified with the qPCR lentivirus titration kit (Applied Biological Materials, catalog #: LV900), and stored at −80°C.
-
bioRxiv - Cell Biology 2022Quote: ... Scrambled siRNA GFP lentivector (catalog #: LV015-G) and Hsp47-set of four siRNA lentivectors (rat) (catalog #: 435050960395) were obtained from Applied Biological Materials. psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... ctDNA was ligated to the PACBIO adaptor (GCGCTCTGTGTGCT) using the ABM DNA Library Prep Kit for Illumina Sequencing (Applied Biological Materials Inc. Canada). PACBio-labeled ctDNA and regular ctDNA were subjected to standard methods for library preparation and sequencing using Illumina and Agilent protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was converted into cDNA using 5x ALL-In-One RT Master Mix (Applied Biological Materials Inc, G490) following the manufacturers’ instructions and diluted 20 times with nuclease-free H2O ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sent to Applied Biological Materials (ABM) for Illumina sequencing ...
-
bioRxiv - Genomics 2022Quote: ... The cells were tested for Mycoplasma contamination with the PCR detection kit (ABM) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and immortalized human cardiac fibroblasts (iHCF, Applied Biological Materials Inc., T0446) were grown in FibroGRO LS medium (Millipore ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... IRF1-pINCY plasmid (Open biosystems) and IRF7 -ORF vector (Applied Biological Materials) was subcloned into pcDNA3 plasmid (Addgene) ...
-
bioRxiv - Microbiology 2022Quote: ... All experiments were performed in triplicates in total reaction volumes of 15 μL using BrightGreen 2X qPCR MasterMix-No Dye (ABM Inc.). A housekeeping gene was used to normalize gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... or OneScript Plus cDNA Synthesis SuperMix (ABM Inc.). cDNAs were amplified on an CFX96 Touch real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed into first-strand cDNA using All-in-one RT MasterMix (Applied Biological Materials). qPCR of cDNA was then performed using P7/P8 primers (5249-5358) ...
-
bioRxiv - Microbiology 2022Quote: ... Equal amount of RNA was converted into cDNA using First Strand cDNA synthesis kit (Applied Biological Materials Inc.). The obtained cDNA was used for SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... syringae Lz4W was routinely grown at 22°C or 4°C (for optimum and low temperatures respectively) in Antarctic bacterial medium (ABM) composed of 5 g/l peptone and 2.0 g/l yeast extract ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ng of DNase-treated RNA was converted into cDNA using Oligo-dT primers in a reaction volume of 10 μl using the OneScript Plus cDNA synthesis kit (Catalog no. G236; ABM). The cDNA was amplified using primer pairs specific to Tat ...
-
bioRxiv - Microbiology 2022Quote: ... viral RNA extracted as indicated above was reverse transcribed with the high-fidelity OneScript Plus Reverse Transcriptase (Applied Biological Materials) using 8 μL of RNA and the primer CVB3_RT_3450 (GTG CTG TGG TCG TGC TCA CTA A) ...
-
bioRxiv - Cancer Biology 2022Quote: ... V5-Tag (ABM, G189). Following three PFS washes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and confirmed mycoplasma free using a PCR detection kit (ABM G238). Recombination of the LSL-Nras allele was verified by PCR using the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: HKDC1 sgRNA CRISPR All-in-One Lentivirus (Human) (Cat No. 234181110603) was purchased from ABM and HepG2 cells (70% confluent ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were regularly passaged and tested for presence of mycoplasma contamination (Mycoplasma PCR Detection Kit, Applied Biological Materials).
-
bioRxiv - Cancer Biology 2021Quote: ... 40 mM Tris-HCl pH 8.0 at 25 °C) and 1.5 U/μL of T7 RNA polymerase (Applied Biological Materials). Reaction mixtures were incubated at 37°C for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cultures were regularly checked for mycoplasma contamination utilizing a PCR detection kit (G238, ABM) or Hoechst staining ...
-
bioRxiv - Immunology 2021Quote: ... The lentivirus titer was measured using a Lentivirus qPCR Titer kit (Applied Biological Materials, Richmond, BC, Canada). For lentiviral transduction ...
-
bioRxiv - Immunology 2021Quote: PAOC cells were immortalized with Lenti-hTERT virus (ABM; cat# G200) following manufacturer’s instructions and clonal sorting/expansion ...
-
bioRxiv - Neuroscience 2021Quote: ... and a universal non-targeting shRNA (LV015-G ABM) were used as control shRNAs.
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Developmental Biology 2021Quote: ... Three gRNA per targeted gene were designed by Applied Biological Materials Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Plant Biology 2021Quote: ... About one microgram of total RNA was reverse transcribed to first strand cDNA in 10 μl reaction using the EasyScript cDNA synthesis kit (Applied Biological Materials) and used for qRT-PCR as described above.
-
bioRxiv - Plant Biology 2021Quote: ... RNAs were reverse transcribed into cDNAs by OneScript Reverse Transcriptase (Applied Biological Materials Inc., Richmond, Canada). qPCR was performed on the total cDNAs using SYBR Premix Ex TaqTM II (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: Variable light and heavy chains of mAb 2F2 and 2E10.E9 antibody genes were sequenced from the hybridomas (BEI Resources MRA-184 and MRA-185, respectively; Applied Biological Materials Inc). Sequenced regions were gene synthesized and cloned (GeneArt ...
-
bioRxiv - Pathology 2021Quote: ... RNA was reverse transcribed (Applied Biological Materials Inc., G454) and specific transcripts were measured using Sybr Green chemistry (Lifesct. ...
-
bioRxiv - Genomics 2021Quote: Reverse transcription is carried out with OneScript Plus Reverse Transcriptase (ABM, G237) in a 20µL volume with the following components and final concentrations ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was performed using the ABM all-in-one 5X RT Mastermix kit (ABM, Richmond, Canada). Primer Express 3.0 software was used for designing primers and quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Immunology 2021Quote: ... Some 500 ng of RNA were reverse transcribed using the ABM 5X RT MasterMix (Applied Biological Materials), as directed by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 µL ViralPlus Transduction Enhancer (Applied Biological Materials Inc., G698) and 40 µL concentrated lentivirus and cultured overnight (Day 1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LSL-SAM insert from one bacterial colony was sequence-verified trough NGS denovo assembly (Applied Biological Materials Inc.), linearized through XhoI digestion and electroporated into G4 mES cells ...
-
bioRxiv - Immunology 2021Quote: ... anti-phospho-Rad52 antibody (Y408472, Applied Biological Materials Inc.) or anti-β-Actin mAb (2F1-1 ...
-
bioRxiv - Microbiology 2021Quote: ... OMV samples were treated with DNase (Applied Biological Materials – abm, British Columbia, Canada) according to the manufacturer’s protocol and stored at −20 °C until use.
-
bioRxiv - Immunology 2021Quote: ... Complementary DNA was generated by qPCR using BrightGreen SYBR Green (Applied Biological Materials). Cq values obtained on a CFX96 PCR System (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Genomics 2021Quote: miRNA All-In-One cDNA Synthesis Kit (Applied Biological Materials, Richmond, BC, Canada) was used to convert RNA to generate ...
-
bioRxiv - Immunology 2021Quote: ... Immortalized mouse dendritic cells (MutuDC1940, Applied Biological Materials Inc. #T0528) were cultured in Iscove’s DMEM medium supplemented with 10% fetal calf serum ...
-
bioRxiv - Immunology 2021Quote: The CBIABM is an agent-based model (ABM). Agent-based modeling is a discrete-event ...
-
bioRxiv - Cell Biology 2021Quote: ... Applied extracellular matrix (ABM) was used to coat culture vessels for cell line maintenance and experiments.
-
bioRxiv - Cell Biology 2021Quote: T0034 immortalized human skeletal muscle cell line was purchased from ABM. Cell were maintained in Prigrow III medium (ABM) ...