Labshake search
Citations for Applied Biological Materials :
51 - 100 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: Titer determination was performed with a RT-qPCR Lentivirus Titer Kit (Applied Biological Materials Inc.) according to the manufacturers’ instructions.
-
bioRxiv - Plant Biology 2024Quote: ... RNA was extracted using a Qiagen RNaeasy extraction kit and cDNA was synthesized using All-In-One 5X RT Master Mix (Applied Biological Materials) containing DNase I ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Immortalized human endometrial stromal cells (T-HESC cell line,[88] Cellosaurus accession no. CVCLC464, female sex) were purchased from Applied Biological Materials, Canada (Ref T0533) ...
-
bioRxiv - Microbiology 2024Quote: ... SLC35A2 (sgRNA: TGCGGGCGTAGCGGATGCTG) or a scrambled sgRNA control (CACTCACATCGCTACATCA) were ordered from Applied Biological Materials Inc ...
-
bioRxiv - Biophysics 2024Quote: ... anti-mouse HRP-conjugated secondary antibody (Applied Biological Materials: SH023)).
-
bioRxiv - Bioengineering 2024Quote: Human BM-MSC (iMSCs: Applied Biological Materials, Richmond, BC, Canada) was expanded in Dulbecco’s modified Eagle’s medium (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... The lentiviral vectors were then titrated with qPCR Lentivirus Titration (Titer) Kit (ABM®, LV900, Richmond, BC, Canada). The absence of mycoplasma was confirmed using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza ...
-
bioRxiv - Microbiology 2024Quote: Lund Human Mesencephalic Cells (LUHMES) were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Microbiology 2024Quote: ... or at the University of Arizona Genetics Core (Applied Biological Materials Inc.). Cells were maintained in sterile cell culture incubators at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Immortalized human epithelial endometriotic cells (12Z cell line,[98] Cellosaurus accession no. CVCL0Q73, female sex) were purchased from Applied Biological Materials, Canada (Ref T0764) ...
-
bioRxiv - Molecular Biology 2024Quote: Amplicon sequencing was done by Applied Biological Materials Inc ...
-
bioRxiv - Immunology 2024Quote: ... The purified RNA products were then treated with RNase R (Applied Biological Materials, E049) according to the manufacturer’s instructions and column purified to get the enriched cmRNA ...
-
bioRxiv - Microbiology 2024Quote: ... The transduction units of the produced lentiviruses were titrated using qPCR Lentivirus Titer Kit (#LV900, ABM, Richmond, BC, Canada).
-
bioRxiv - Paleontology 2024Quote: The study comprises of three southern Levant samples from Iron Age 2 Abel Beth Maacah (ABM, N=74), Iron Age 2 Tel Dor (Dor ...
-
bioRxiv - Paleontology 2024Quote: ... It is also worth noting that the astragali from ABM were recovered from a jar that held more than 400 astragali of diverse artiodactyls (Susnow et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1% (v/v) antibiotic/antimycotic solution (ABM; Gibco).
-
bioRxiv - Cancer Biology 2024Quote: pLenti-CMV-RARγ-C vector (GFP) and pLenti-CMV-TACC1-C vector (MYC) and pLenti-III-Blank vector were custom synthesized (Applied Biological Materials). Lentiviral MOI were as per manufacturer’s protocol(41 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were regularly tested negative for mycoplasma contamination using Mycoplasma PCR Detection Kit (Applied Biological Materials Inc; G238). Identity of the cell lines were verified by STR analysis.
-
bioRxiv - Cancer Biology 2024Quote: ... All lines were routinely tested for mycoplasma infection (#G238, Applied biological Materials, Ferndale, WA).
-
bioRxiv - Cancer Biology 2024Quote: ... Cells tested negative for mycoplasma contamination (Applied Biological Materials Inc, catalogue number: G238).
-
bioRxiv - Cancer Biology 2024Quote: ... Astrocytes were cultured in astrocyte basal growth media (ABM™, CC-3187) with astrocyte growth medium supplements (AGM CC-3186) ...
-
bioRxiv - Cell Biology 2024Quote: ... Crude adenoviral HEK293A cell lysate expressing JOSD1 was purchased from ABM (#252540540200) [New York ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were regularly tested for their mycoplasma negativity by using and following the manufactureŕs instructions of the PCR Mycoplasma detection kit (ABM). Cell growth and survival was measured by regular cell counting using a CASY counter (OLS OMNI Life Science).
-
bioRxiv - Cancer Biology 2024Quote: ... Clonetics AGMTM Astrocyte Growth Medium BulletKitTM (comprised of ABM-astrocyte basal medium and SingleQuotsTM growth factors ...
-
bioRxiv - Neuroscience 2024Quote: ... Astrocytes were labeled for live assays prior to incorporation into miBrains using an AAV (pAAV-CAG-tdTomato, Addgene or AAV9-CAG-GFP, Applied Biological Materials). Microglia were labeled for live assays prior to incorporation using a cell membrane dye (Vybrant Cell-Labeling Solutions ...
-
bioRxiv - Physiology 2024Quote: ... was subcloned and packaged in an AAV serotype retrograde (Applied Biological Materials, Inc.). A total volume of 10 -20μl of AAVrg-mCherry-FLEX-dtA (titer ...
-
bioRxiv - Immunology 2024Quote: ... BlasTaq™ 2X qPCR MasterMix (ref. G892-1, Applied Biological Materials, Vancouver, Canada) and specific primers were used to assess gene transcripts expression for following targets ...
-
bioRxiv - Plant Biology 2024Quote: ... which was carried out using the BlasTaq 2X qPCR Mater Mix (ABM, Richmond, Canada) in an Light Cycler 86 apparatus (Roche ...
-
bioRxiv - Physiology 2024Quote: ... ORAI Stable Triple Knockout HEK293 (ORAI 3KO) were from Applied Biological Materials (Ferndale, WA, USA) [81] ...
-
bioRxiv - Genomics 2024Quote: ... which are commercially available from Applied Biological Materials Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... copper and titanium were electron beam evaporated (Kurt Lesker Axiss PVD System) and patterned via photolithography (ABM-USA, INC., Jan Jose, CA, USA), (Figure 1B ...
-
bioRxiv - Molecular Biology 2024Quote: ... Human RPL22 and RPL22L1 cDNAs were amplified from pLenti-GIII-CMV-RPL22-HA and pLenti-GIII-CMV-RPL22L1-HA (Applied Biological Materials, cat # LV291610, cat # LV802168) then cloned into a PB-EF1α-MCS- IRES-GFP PiggyBac expression vector (System Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2 wildtype cells were also provided from Synthego and regularly checked for mycoplasma contamination (PCR Mycoplasma Detection Kit, ABM). Cell lines were seeded in 10 cm2 plates and grown at 5% CO2 and 37 C ...
-
bioRxiv - Bioengineering 2024Quote: Human lung fibroblasts (hTERT T1015 cell line purchased from Applied Biological Materials Inc.) were used before passage 5 for all experiments ...
-
bioRxiv - Synthetic Biology 2024Quote: ... TO1B was purchased from Applied Biological Materials.
-
bioRxiv - Biochemistry 2024Quote: Methods of cell growth and propagation for the IHCF cell line followed instructions provided by Applied Biological Materials Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was synthesized using the All-In-One 5X RT MasterMix (ABM, #G592). qPCR was performed using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... Mycoplasma screening was performed using the ABM Mycoplasma PCR detection kit (Applied Biological Materials Inc).
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from the PBMCs and reverse-transcribed into cDNA using All-In-One 5X RT MasterMix (Applied Biological Materials Inc, BC, Canada). Real-time PCR amplification of the cDNA was analyzed using Bright Green 2X qPCR Master Mix-Low ROX (Applied Biological Materials Inc ...
-
bioRxiv - Immunology 2024Quote: ... Real-time PCR amplification of the cDNA was analyzed using Bright Green 2X qPCR Master Mix-Low ROX (Applied Biological Materials Inc, BC, Canada) and QS12K Flex system (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro containing 3 different sgRNAs against SUB1 were obtained from ABM goods.
-
bioRxiv - Bioengineering 2024Quote: ... Cells were checked regularly for mycoplasma infections using the PCR Mycoplasma Detection Kit (G238; ABM, New York, NY).
-
bioRxiv - Cancer Biology 2024Quote: ... using TROP2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (ABM, 460591140595). A CRISPR/Cas9 vector with non-targeting sgRNA (ABM ...
-
bioRxiv - Cancer Biology 2024Quote: ... A CRISPR/Cas9 vector with non-targeting sgRNA (ABM, K010) was used to generate control Trop2-WT cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... and control construct were synthesized by Applied Biological Materials.
-
bioRxiv - Biophysics 2024Quote: ... NeuroMab) and HRP-conjugated goat anti-mouse antibody (1:30,000 dilution; HS023; Applied Biological Materials). β-actin was used as a loading control and detected using the β-actin monoclonal antibody (1:10,000 dilution ...
-
bioRxiv - Genetics 2024Quote: ... Viral titers were assessed by qPCR Lenti/Retrovirus Titer Kits (ABM, Canada).
-
bioRxiv - Biophysics 2024Quote: Genes encoding wild-type or mutant XPR1 were cloned into the lentiviral expression vector pLenti-GIII-CMV (Applied Biological Materials) and encodes the full-length protein followed by a C-terminal mCerulean tag ...
-
bioRxiv - Biophysics 2024Quote: ... Both siScr and siCRB2 podocytes were established through lentiviral transduction with scrambled and CRB2 siRNA (Applied Biological Materials), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... using BlasTaq™ 2X qPCR MasterMix (ABM, G891) and cDNA was diluted to 1:40 ...