Labshake search
Citations for Applied Biological Materials :
1 - 50 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... In the cases where the ABM time point is longer than the trajectory predicted by the Boolean (i.e., the CD8+ T cell has reached its terminally differentiated state before the current ABM simulation timepoint), we assume the T cell remains in its final state (the last value in its trajectory predicted by the Boolean model ...
-
bioRxiv - Bioengineering 2024Quote: ... The viral titer was determined by RT‒qPCR using the titer kit from Applied Biological Materials prior to use.
-
bioRxiv - Cell Biology 2024Quote: ... and mycoplasma contamination was regularly assessed using the polymerase chain reaction (PCR) mycoplasma detection kit (G238, ABM).
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cDNA synthesis using Applied Biological Materials (ABM) All in one 5X Master Mix ...
-
bioRxiv - Genomics 2024Quote: ... SV40-immortalized human microglia cells (Cat.No: T0251, Applied Biological Materials Inc, Richmond, QC, Canada), was cultured in Prigrow III medium with 10% (vol/vol ...
-
bioRxiv - Neuroscience 2024Quote: ... The TPP1LAMP1 transgene and the regular hTPP1 cDNA were each synthesized and inserted into the multiple cloning site of pLenti-III-PGK plasmid vector (Applied Biological Materials, Canada, Cat. No. G305). TPP1LAMP1 and TPP1 lentiviruses (LV-TPP1LAMP1 and LV-TPP1 ...
-
bioRxiv - Immunology 2024Quote: Immortalized human fetal astrocytes-SV40 (IMhu-A) (Applied Biological Materials, Cat. No. T0280) cells were grown in Roswell Park Memorial Institute (RPMI)-HEPES medium (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... The immortalized human microglia-SV40 (IMhu-M) cell line (Applied Biological Materials, Cat. No. T0251), HEK293(T ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was synthesized from RNA at the appropriate concentration using Onescript Plus Reverse Transcriptase cDNA Synthesis Kit (ABM, USA) according to the manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... hsa-miR-203a miRNA mimic (MIMAT0000264) and antagomir (MIMAT0031890) were obtained from ABM.
-
bioRxiv - Cell Biology 2024Quote: PCR-based mycoplasma detection was performed using the Mycoplasma PCR detection kit (Applied Biological Materials) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: ... Other constructs were synthesized by Twist Biosciences (South San Francisco, CA) or using site-directed mutagenesis either in-house or by Applied Biological Materials (Richmond, Canada). The HCN4 Δ1-62 ...
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR/Cas9 system specifically targeting human ATG7 (K0142505) was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... packaging vectors and with the transfer plasmid (Txn1 sgRNA CRISPR/Cas9, ABM Inc# 48866114) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... Scramble (LV-shRNA-scramble, #LVP015-G) and Trx1 shRNA plasmids (LV-shRNA-Trx1, #488660940395) were purchased from Applied Biological Materials Inc. ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...
-
bioRxiv - Bioengineering 2024Quote: ... woodii was cultivated in 12 ml of acetobacterium medium (DSMZ 135, referred as ABM) which was prepared according to DSMZ’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral media was filtered (0.45 μm) and tested using lentiviral titration card (ABM Biologics). Active lentivirus was concentrated by mixing viral media with 4X lentiviral concentration solution (40% w/v PEG-8000 ...
-
bioRxiv - Biochemistry 2024Quote: ... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
bioRxiv - Cancer Biology 2024Quote: ... SUM149pt was purchased from Applied Biological Materials, Inc ...
-
bioRxiv - Cancer Biology 2024Quote: All 2D and 3D cultures were assessed for mycoplasma monthly via the highly sensitive PCR-based kit from ABM (cat. G238). Where applicable ...
-
bioRxiv - Cell Biology 2024Quote: ... gRNA3: TGGTACAGGTTCTACTAAAC (ABM, 19075111). Two days after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... and human CDC14A siRNA and scrambled siRNA (i504211) were from Applied Biological Materials (Richmond, BC, Canada). FAK-14 inhibitor was from Tocris Bioscience (Bristol ...
-
bioRxiv - Neuroscience 2024Quote: Immortalized DPCs were obtained from Applied Biological Materials (Richmond, BC, Canada). SH-SY5Y cells (a human neuroblastoma line ...
-
bioRxiv - Cell Biology 2024Quote: ... were performed using the Python (V3.9) programming language and the NumPy library (https://github.com/cas-mitolab/Fertilization_ABM)[18].
-
bioRxiv - Cell Biology 2024Quote: ... The models and other supporting information are available at (https://github.com/cas-mitolab/Fertilization_ABM). Simulations were run on a standard laptop computer with 16 GB of RAM and an Intel Core i7 1.7GHz processor ...
-
bioRxiv - Cell Biology 2024Quote: ... A separate agent-based model was designed to facilitate drawing and saving the environment (available at https://github.com/cas-mitolab/Fertilization_ABM). White barriers are imposed in the model as boundaries that sperm cannot cross ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines tested negative for mycoplasma using a PCR mycoplasma detection kit (#G238, Applied Biological Materials Inc., Richmond, BC, Canada). Cell lines were cultured in RPMI-1640 medium (#350-000-CL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were tested negative for mycoplasma using a PCR detection kit (#G238, Applied Biological Materials Inc.). Rho-0 cells were generated from parental MeWo cells cultured in media containing 50 µg/mL uridine (#URD222 ...
-
bioRxiv - Bioengineering 2024Quote: ... and the thickness of the droplet generator mold was 40 μm controlled by adjusting the rotation speed of spin coating in conjunction with the UV exposure time under a mask aligner (ABM 3000HR Mask Aligner, ABM, NY, USA). To produce the master for the bottom trap channel of a microwell array ...
-
bioRxiv - Bioengineering 2024Quote: ... and the thickness of the droplet generator mold was 40 μm controlled by adjusting the rotation speed of spin coating in conjunction with the UV exposure time under a mask aligner (ABM 3000HR Mask Aligner, ABM, NY, USA). To produce the master for the bottom trap channel of a microwell array ...
-
bioRxiv - Bioengineering 2024Quote: ... exposed using a contact aligner and chrome masks (ABM), and developed with AZ400K (Microchem) ...
-
bioRxiv - Biochemistry 2024Quote: ... LN229 and MDA-MB-468 cell lines were maintained at 37°C and 5% CO2 and tested regularly for mycoplasma contamination using a mycoplasma detection kit (Applied Biological Materials, G238). Cells were cultured in either RPMI (Thermo ...
-
bioRxiv - Molecular Biology 2024Quote: ... titrated by Applied Biological Materials Inc ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were routinely tested for mycoplasma infection using PCR Mycoplasma Detection Kit (ABM#G238).
-
bioRxiv - Systems Biology 2024Quote: ... Simulations were performed on the Big Red 3 supercomputer at Indiana University (scheduling jobs, simulation and analyzing output data. See Fig. 7 for schematic diagram of large-scale parameters exploration for ABM framework). Each simulation was run on a single node using 24 threads ...
-
bioRxiv - Cell Biology 2024Quote: ... gel electrophoresis using 1X tris–borate–EDTA buffer alongside a 100 base pair ladder using SafeView™ Classic (Applied Biological Materials, Cat No. G108) nucleic acid stain and Gel Loading Dye ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus titers were determined using a qRT-PCR lentivirus titration kit (ABM, Cat # LV900). For viral transduction ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was reverse transcribed using a 5X All-In-One RT MasterMix (Cat# G590; Applied Biological Materials Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... for Mycoplasma testing (Applied Biological Materials, C214). The remainder of the cells were washed once with phosphate buffered saline (ThermoFisher ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg RNA was reverse-transcribed to cDNA using the All-in-One 5x RT Mastermix kit (ABM). Gene expression primers were designed using Primer Express 3.0 software and are listed in Table S5 ...
-
bioRxiv - Genetics 2024Quote: ... cells were cultured in cell medium (Cat. no. TM002, ABM) containing 10% FBS (Cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were routinely checked for mycoplasma contamination using Mycoplasma PCR Detection kit (Applied Biological Materials).
-
bioRxiv - Cancer Biology 2024Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Molecular Biology 2024Quote: ... (ABM).
-
bioRxiv - Bioengineering 2024Quote: ... with 1% antibiotic-antimycotic solution (ABM, Thermo Fischer) in gelatine-coated (2% ...
-
bioRxiv - Cell Biology 2024Quote: ... Rabbit Anti-PKA-RIβ (ABM catalog #Y051648) diluted 1:2 ...