Labshake search
Citations for Applied Biological Materials :
1 - 50 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... hsa-miR-203a miRNA mimic (MIMAT0000264) and antagomir (MIMAT0031890) were obtained from ABM.
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cDNA synthesis using Applied Biological Materials (ABM) All in one 5X Master Mix ...
-
bioRxiv - Cell Biology 2024Quote: PCR-based mycoplasma detection was performed using the Mycoplasma PCR detection kit (Applied Biological Materials) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral media was filtered (0.45 μm) and tested using lentiviral titration card (ABM Biologics). Active lentivirus was concentrated by mixing viral media with 4X lentiviral concentration solution (40% w/v PEG-8000 ...
-
bioRxiv - Biochemistry 2024Quote: ... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
bioRxiv - Bioengineering 2024Quote: ... woodii was cultivated in 12 ml of acetobacterium medium (DSMZ 135, referred as ABM) which was prepared according to DSMZ’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... gRNA3: TGGTACAGGTTCTACTAAAC (ABM, 19075111). Two days after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... packaging vectors and with the transfer plasmid (Txn1 sgRNA CRISPR/Cas9, ABM Inc# 48866114) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... Scramble (LV-shRNA-scramble, #LVP015-G) and Trx1 shRNA plasmids (LV-shRNA-Trx1, #488660940395) were purchased from Applied Biological Materials Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: All 2D and 3D cultures were assessed for mycoplasma monthly via the highly sensitive PCR-based kit from ABM (cat. G238). Where applicable ...
-
bioRxiv - Cancer Biology 2024Quote: ... SUM149pt was purchased from Applied Biological Materials, Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... and mycoplasma contamination was regularly assessed using the polymerase chain reaction (PCR) mycoplasma detection kit (G238, ABM).
-
bioRxiv - Genomics 2024Quote: ... SV40-immortalized human microglia cells (Cat.No: T0251, Applied Biological Materials Inc, Richmond, QC, Canada), was cultured in Prigrow III medium with 10% (vol/vol ...
-
bioRxiv - Immunology 2024Quote: Immortalized human fetal astrocytes-SV40 (IMhu-A) (Applied Biological Materials, Cat. No. T0280) cells were grown in Roswell Park Memorial Institute (RPMI)-HEPES medium (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... The immortalized human microglia-SV40 (IMhu-M) cell line (Applied Biological Materials, Cat. No. T0251), HEK293(T ...
-
bioRxiv - Neuroscience 2024Quote: ... The TPP1LAMP1 transgene and the regular hTPP1 cDNA were each synthesized and inserted into the multiple cloning site of pLenti-III-PGK plasmid vector (Applied Biological Materials, Canada, Cat. No. G305). TPP1LAMP1 and TPP1 lentiviruses (LV-TPP1LAMP1 and LV-TPP1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR/Cas9 system specifically targeting human ATG7 (K0142505) was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was synthesized from RNA at the appropriate concentration using Onescript Plus Reverse Transcriptase cDNA Synthesis Kit (ABM, USA) according to the manufacturer recommendations ...
-
bioRxiv - Biophysics 2024Quote: ... Other constructs were synthesized by Twist Biosciences (South San Francisco, CA) or using site-directed mutagenesis either in-house or by Applied Biological Materials (Richmond, Canada). The HCN4 Δ1-62 ...
-
bioRxiv - Systems Biology 2024Quote: ... In the cases where the ABM time point is longer than the trajectory predicted by the Boolean (i.e., the CD8+ T cell has reached its terminally differentiated state before the current ABM simulation timepoint), we assume the T cell remains in its final state (the last value in its trajectory predicted by the Boolean model ...
-
bioRxiv - Biochemistry 2024Quote: ... and human CDC14A siRNA and scrambled siRNA (i504211) were from Applied Biological Materials (Richmond, BC, Canada). FAK-14 inhibitor was from Tocris Bioscience (Bristol ...
-
bioRxiv - Bioengineering 2024Quote: ... The viral titer was determined by RT‒qPCR using the titer kit from Applied Biological Materials prior to use.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were routinely tested for mycoplasma infection using PCR Mycoplasma Detection Kit (ABM#G238).
-
bioRxiv - Synthetic Biology 2024Quote: ... for Mycoplasma testing (Applied Biological Materials, C214). The remainder of the cells were washed once with phosphate buffered saline (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was reverse transcribed using a 5X All-In-One RT MasterMix (Cat# G590; Applied Biological Materials Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... gel electrophoresis using 1X tris–borate–EDTA buffer alongside a 100 base pair ladder using SafeView™ Classic (Applied Biological Materials, Cat No. G108) nucleic acid stain and Gel Loading Dye ...
-
bioRxiv - Genetics 2024Quote: ... cells were cultured in cell medium (Cat. no. TM002, ABM) containing 10% FBS (Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... Rabbit Anti-PKA-RIβ (ABM catalog #Y051648) diluted 1:2 ...
-
bioRxiv - Bioengineering 2024Quote: ... and the thickness of the droplet generator mold was 40 μm controlled by adjusting the rotation speed of spin coating in conjunction with the UV exposure time under a mask aligner (ABM 3000HR Mask Aligner, ABM, NY, USA). To produce the master for the bottom trap channel of a microwell array ...
-
bioRxiv - Bioengineering 2024Quote: ... and the thickness of the droplet generator mold was 40 μm controlled by adjusting the rotation speed of spin coating in conjunction with the UV exposure time under a mask aligner (ABM 3000HR Mask Aligner, ABM, NY, USA). To produce the master for the bottom trap channel of a microwell array ...
-
bioRxiv - Paleontology 2024Quote: The study comprises of three southern Levant samples from Iron Age 2 Abel Beth Maacah (ABM, N=74), Iron Age 2 Tel Dor (Dor ...
-
bioRxiv - Paleontology 2024Quote: ... It is also worth noting that the astragali from ABM were recovered from a jar that held more than 400 astragali of diverse artiodactyls (Susnow et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1% (v/v) antibiotic/antimycotic solution (ABM; Gibco).
-
bioRxiv - Immunology 2024Quote: ... BlasTaq™ 2X qPCR MasterMix (ref. G892-1, Applied Biological Materials, Vancouver, Canada) and specific primers were used to assess gene transcripts expression for following targets ...
-
bioRxiv - Molecular Biology 2024Quote: ... (ABM).
-
bioRxiv - Bioengineering 2024Quote: ... with 1% antibiotic-antimycotic solution (ABM, Thermo Fischer) in gelatine-coated (2% ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti-CMV-RARγ-C vector (GFP) and pLenti-CMV-TACC1-C vector (MYC) and pLenti-III-Blank vector were custom synthesized (Applied Biological Materials). Lentiviral MOI were as per manufacturer’s protocol(41 ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Neuroscience 2024Quote: ... Astrocytes were labeled for live assays prior to incorporation into miBrains using an AAV (pAAV-CAG-tdTomato, Addgene or AAV9-CAG-GFP, Applied Biological Materials). Microglia were labeled for live assays prior to incorporation using a cell membrane dye (Vybrant Cell-Labeling Solutions ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg RNA was reverse-transcribed to cDNA using the All-in-One 5x RT Mastermix kit (ABM). Gene expression primers were designed using Primer Express 3.0 software and are listed in Table S5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were routinely checked for mycoplasma contamination using Mycoplasma PCR Detection kit (Applied Biological Materials).
-
bioRxiv - Plant Biology 2024Quote: ... RNA was extracted using a Qiagen RNaeasy extraction kit and cDNA was synthesized using All-In-One 5X RT Master Mix (Applied Biological Materials) containing DNase I ...
-
bioRxiv - Bioengineering 2024Quote: Human BM-MSC (iMSCs: Applied Biological Materials, Richmond, BC, Canada) was expanded in Dulbecco’s modified Eagle’s medium (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... copper and titanium were electron beam evaporated (Kurt Lesker Axiss PVD System) and patterned via photolithography (ABM-USA, INC., Jan Jose, CA, USA), (Figure 1B ...
-
bioRxiv - Molecular Biology 2024Quote: ... Human RPL22 and RPL22L1 cDNAs were amplified from pLenti-GIII-CMV-RPL22-HA and pLenti-GIII-CMV-RPL22L1-HA (Applied Biological Materials, cat # LV291610, cat # LV802168) then cloned into a PB-EF1α-MCS- IRES-GFP PiggyBac expression vector (System Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2 wildtype cells were also provided from Synthego and regularly checked for mycoplasma contamination (PCR Mycoplasma Detection Kit, ABM). Cell lines were seeded in 10 cm2 plates and grown at 5% CO2 and 37 C ...