Labshake search
Citations for Applied Biological Materials :
1 - 50 of 432 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR/Cas9 system specifically targeting human ATG7 (K0142505) was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... and human CDC14A siRNA and scrambled siRNA (i504211) were from Applied Biological Materials (Richmond, BC, Canada). FAK-14 inhibitor was from Tocris Bioscience (Bristol ...
-
bioRxiv - Systems Biology 2024Quote: ... In the cases where the ABM time point is longer than the trajectory predicted by the Boolean (i.e., the CD8+ T cell has reached its terminally differentiated state before the current ABM simulation timepoint), we assume the T cell remains in its final state (the last value in its trajectory predicted by the Boolean model ...
-
bioRxiv - Bioengineering 2024Quote: ... The viral titer was determined by RT‒qPCR using the titer kit from Applied Biological Materials prior to use.
-
bioRxiv - Cell Biology 2024Quote: ... and mycoplasma contamination was regularly assessed using the polymerase chain reaction (PCR) mycoplasma detection kit (G238, ABM).
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cDNA synthesis using Applied Biological Materials (ABM) All in one 5X Master Mix ...
-
bioRxiv - Genomics 2024Quote: ... SV40-immortalized human microglia cells (Cat.No: T0251, Applied Biological Materials Inc, Richmond, QC, Canada), was cultured in Prigrow III medium with 10% (vol/vol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cells were passaged weekly and regularly tested for mycoplasma contamination by PCR-based assay (G238; ABM). To investigate the expression of miR-146a-5p under inflammatory stress ...
-
PI3K/HSCB axis facilitates FOG1 nuclear translocation to promote erythropoiesis and megakaryopoiesisbioRxiv - Molecular Biology 2024Quote: ... the 20-μL reaction systems were established with the cDNA samples and the gene-specific primers listed in Table S2 based on the BlasTaq™ 2X qPCR MasterMix (G891, ABM, Canada). All reactions were performed on the QuantStudio™ 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... The TPP1LAMP1 transgene and the regular hTPP1 cDNA were each synthesized and inserted into the multiple cloning site of pLenti-III-PGK plasmid vector (Applied Biological Materials, Canada, Cat. No. G305). TPP1LAMP1 and TPP1 lentiviruses (LV-TPP1LAMP1 and LV-TPP1 ...
-
PI3K/HSCB axis facilitates FOG1 nuclear translocation to promote erythropoiesis and megakaryopoiesisbioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from erythroid/megakaryocytic progenitor or K562 cells using the RNA Isolation Kit (Omn-02, Omiget, China) and reverse-transcribed into cDNA with the All-In-One 5X RT MasterMix (G592, ABM, Canada). For qRT-PCR ...
-
bioRxiv - Immunology 2024Quote: Immortalized human fetal astrocytes-SV40 (IMhu-A) (Applied Biological Materials, Cat. No. T0280) cells were grown in Roswell Park Memorial Institute (RPMI)-HEPES medium (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... The immortalized human microglia-SV40 (IMhu-M) cell line (Applied Biological Materials, Cat. No. T0251), HEK293(T ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was synthesized from RNA at the appropriate concentration using Onescript Plus Reverse Transcriptase cDNA Synthesis Kit (ABM, USA) according to the manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were periodically evaluated for mycoplasma contamination by a mycoplasma PCR detection kit (Cat# G238, ABM). Authenticity of cell lines was evaluated by detection of ten genetic loci using the GenePrint® 10 System (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... hsa-miR-203a miRNA mimic (MIMAT0000264) and antagomir (MIMAT0031890) were obtained from ABM.
-
bioRxiv - Microbiology 2024Quote: ... Cells were monitored routinely for mycoplasma contamination using a mycoplasma detection PCR kit (ABM, G238). A FLAG (NiV-F-FLAG ...
-
bioRxiv - Biochemistry 2024Quote: ... packaging vectors and with the transfer plasmid (Txn1 sgRNA CRISPR/Cas9, ABM Inc# 48866114) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... Scramble (LV-shRNA-scramble, #LVP015-G) and Trx1 shRNA plasmids (LV-shRNA-Trx1, #488660940395) were purchased from Applied Biological Materials Inc. ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...
-
bioRxiv - Bioengineering 2024Quote: ... woodii was cultivated in 12 ml of acetobacterium medium (DSMZ 135, referred as ABM) which was prepared according to DSMZ’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral media was filtered (0.45 μm) and tested using lentiviral titration card (ABM Biologics). Active lentivirus was concentrated by mixing viral media with 4X lentiviral concentration solution (40% w/v PEG-8000 ...
-
bioRxiv - Biochemistry 2024Quote: ... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
bioRxiv - Cancer Biology 2024Quote: ... SUM149pt was purchased from Applied Biological Materials, Inc ...
-
bioRxiv - Cancer Biology 2024Quote: All 2D and 3D cultures were assessed for mycoplasma monthly via the highly sensitive PCR-based kit from ABM (cat. G238). Where applicable ...
-
bioRxiv - Cell Biology 2024Quote: ... gRNA3: TGGTACAGGTTCTACTAAAC (ABM, 19075111). Two days after transfection ...
-
bioRxiv - Cell Biology 2024Quote: PCR-based mycoplasma detection was performed using the Mycoplasma PCR detection kit (Applied Biological Materials) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: ... Other constructs were synthesized by Twist Biosciences (South San Francisco, CA) or using site-directed mutagenesis either in-house or by Applied Biological Materials (Richmond, Canada). The HCN4 Δ1-62 ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized by reverse transcription using All-In-One 5X RT Master Mix (ABM-G592) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reaction mixtures (25 μl) consisted of 12.5 μl of MegaFi Fidelity 2X PCR MasterMix (ABM Inc., Richmond, Canada), 1.5 μl of each primer (final concentration 0.6 μM) ...
-
bioRxiv - Physiology 2023Quote: ... RNA samples underwent reverse transcription (All-in-one RT Master Mix – ABM). qPCR was performed with BrightGreen Express reagent (ABM ...
-
bioRxiv - Physiology 2023Quote: ... qPCR was performed with BrightGreen Express reagent (ABM) and run on the CFX384 Real-Time PCR system for 40 cycles ...
-
bioRxiv - Physiology 2023Quote: ... Coronary Arterial Smooth Muscle cells (CSM; Applied Biological Materials T0557) were propagated and prepared in the same manner ...
-
bioRxiv - Neuroscience 2023Quote: ... included recordings of individuals between the ages of 40-90 that were collected at four sites in the United Sates: Advanced Brain Monitoring (ABM) in Carlsbad ...
-
bioRxiv - Cancer Biology 2023Quote: ... BON shControl and shTPH1 cell lines were generated using lentiviral transduction system with shRNA expression plasmids from Applied Biological Materials Inc ...
-
bioRxiv - Physiology 2023Quote: ... utilizing BrightGreen Express 2x qPCR MasterMix - iCycler (ABM; cat no. MasterMix-EC). Products were amplified at 95°C for 3 minutes followed by cycles of 95°C for 15s ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized using OneScript cDNA Synthesis SuperMix (ABM; cat no. G452). qPCR was performed in a CFX-Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The second approach was to use an Agent-based model (ABM) which allowed us to consider spatial effects and analyse the effect of multicellularity on the dynamics of the system ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were periodically evaluated for mycoplasma contamination by a mycoplasma PCR detection kit (Cat# G238, ABM). Cells were genotyped at the beginning and end of the study.
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... or BrightGreen Express MasterMix (ABM) with custom-designed primers (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Neuroscience 2023Quote: ... All lines were routinely tested for mycoplasma infection (#G238, Applied biological Materials, Ferndale, WA).
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized from 500 ng total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biological Materials Inc). qRT-PCR was performed using an Applied Biosystems StepOne Plus qPCR instrument with SYBR™ Select Master Mix according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: We implemented an extension of the agent-based model (ABM) found in (30) ...
-
bioRxiv - Cell Biology 2023Quote: Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rabbit polyclonal to HA tag (Applied Biological Materials Cat# G166, RRID:AB_2813867). The Rabbit monoclonal to phospho-Smad 1/5 (Cell Signaling Technology Cat# 9516 ...