Labshake search
Citations for Applied Biological Materials :
101 - 150 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and RNase R (1 µl, 10 U/µl, ABM) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA was synthesized from 2µg of RNA samples with the One Script Plus cDNA Synthesis Kit (ABM). The qPCR reactions were made using either the Applied Biosystems™ PowerUp™ SYBR™ Green Master Mix (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: ... Air bubbles introduced during the mixing process were removed by centrifugation for 1 minute at 1500 rpm (Benchtop Centrifuge, #Q5120, ABM). Cell-laden hydrogel syringes were then incubated (37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... or CBP (#168160960395) as well as non-targeting control siRNA (# LV015-G) from Applied Biological Materials (abm; Richmond, BC, Canada), using Trans IT-Virus GEN transfection Reagent (Mirus) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adenoviruses expressing DDR1 and DDR2 were from Applied Biological Materials, and were amplified as described [33].
-
bioRxiv - Biochemistry 2024Quote: ... The titer of virus was measured using the qPCR Retrovirus Titer Kit (ABM, G949). If the titer was less than 2×106 IU/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sgRNA template for tp53 R242H knock-in was generated by performing an overlap-extension PCR of p53-R242_sgRNA-2_sense and Rev-sgRNA-scaffold oligos using Taq DNA polymerase (ABM, G009) by combining 10 μl of 10× buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Routine Mycoplasma testing was performed using Mycoplasma Detection Kit (ABM, Cat # G238).
-
bioRxiv - Bioengineering 2024Quote: ... purified RNA was treated with RNase R (Applied Biological Materials, Richmond, BC, Canada). RNase R is a 3′ to 5′ exoribonuclease that digests linear structures ...
-
bioRxiv - Bioengineering 2024Quote: Human lung fibroblasts (hTERT T1015 cell line purchased from Applied Biological Materials Inc.) were used before passage 5 for all experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... Routine Mycoplasma testing was performed using Mycoplasma Detection Kit (ABM, Cat # G238). STR profiling for cell lines were done at MD Anderson Cancer Center core facility.
-
bioRxiv - Cancer Biology 2024Quote: ... RRID:Addgene_85140)75 and packaged with a 3rd generation lentivirus packaging system (ABM, LV053). CAF12 cells were transduced with hTERT plasmid-containing lentivirus followed by selection with 50 μg/mL hygromycin B (EnzoLifeSciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus particles carrying these expression plasmids were generated using a 3rd generation virus packaging kit (ABM LV053) by transfecting HEK293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... were generated using a 3rd generation virus packaging system (ABM, LV053) by transfecting HEK293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... using BlasTaq™ 2X qPCR MasterMix (ABM, G891) and cDNA was diluted to 1:40 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the packaging plasmids (pLenti-P2A and pLenti-P2B, Cat. # LV003, Applied Biological Materials Inc. Richmond, BC, Canada), using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... and the cDNA was synthesized using OneScript® Plus cDNA Synthesis Kit (ABM, Richmond, BC, Canada). Real-time PCR was carried out on a 7900HT Fast Real-Time PCR system using PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: Testing for mycoplasma contamination was performed using a commercial mycoplasma PCR kit (PCR Mycoplasma Detection kit; Applied Biological Materials Incorporated, BC, Canada). The testing was done at two stages of the workflow ...
-
bioRxiv - Genomics 2024Quote: 1 mL of 2×105 cells/mL iHCF (ABM Cat# T0446) cell suspension prepared with FibroGROTM-LS complete media (Millipore Sigma Cat # SCMF002 ...
-
bioRxiv - Genomics 2024Quote: Pools of immortalized human cardiac fibroblasts (iHCF) (Applied Biological Materials, Inc.) were co-transduced with lentiviruses containing guides against the same enhancer locus and Cas9-Blasticidin lentivirus (Transomic ...
-
bioRxiv - Cell Biology 2024Quote: ... in humidified incubators and routinely tested for mycoplasma contamination using the Mycoplasma PCR Detection Kit (ABM, #G238). All cell lines are commercially available (ATCC).
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviruses expressing Cas9 and sgRNAs were produced by co-transfecting HEK293T cells with sgRNAs and packaging plasmids (ABM, LV003) as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Single guide RNAs (sgRNA) targeting the rat GPRASP1 (GASP1 protein) gene were purchased from Applied Biological Materials (ABM, 22601116). The sgRNAs target three distinct sites of the GPRASP1 gene and were cloned into a lentiviral vector system (pLenti-U6) ...
-
bioRxiv - Cell Biology 2024Quote: ... gene were purchased from Applied Biological Materials (ABM, 22601116). The sgRNAs target three distinct sites of the GPRASP1 gene and were cloned into a lentiviral vector system (pLenti-U6) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The second approach was to use an Agent-based model (ABM) which allowed us to consider spatial effects and analyse the effect of multicellularity on the dynamics of the system ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were periodically evaluated for mycoplasma contamination by a mycoplasma PCR detection kit (Cat# G238, ABM). Cells were genotyped at the beginning and end of the study.
-
bioRxiv - Neuroscience 2023Quote: ... included recordings of individuals between the ages of 40-90 that were collected at four sites in the United Sates: Advanced Brain Monitoring (ABM) in Carlsbad ...
-
bioRxiv - Cancer Biology 2023Quote: ... BON shControl and shTPH1 cell lines were generated using lentiviral transduction system with shRNA expression plasmids from Applied Biological Materials Inc ...
-
bioRxiv - Physiology 2023Quote: ... utilizing BrightGreen Express 2x qPCR MasterMix - iCycler (ABM; cat no. MasterMix-EC). Products were amplified at 95°C for 3 minutes followed by cycles of 95°C for 15s ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized using OneScript cDNA Synthesis SuperMix (ABM; cat no. G452). qPCR was performed in a CFX-Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: Human VSMCs and mouse VSMCs were purchased from Applied Biological Materials (T0515, Richmond, Canada) and American Type Culture Collection (ATCC) ...
-
bioRxiv - Bioengineering 2023Quote: ... (A) ECM models: artificial connective tissues (ACT) and artificial basement membrane (ABM), (B ...
-
bioRxiv - Bioengineering 2023Quote: ... called artificial basement membrane (ABM), type I collagen (1 mg/mL in PBS) ...
-
bioRxiv - Cancer Biology 2023Quote: All-in-one lentiviral vectors encoding both the RNA guide (gRNA) and the Cas9 protein for AR gene deletion were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription to generate cDNA was performed using the ABM All-In-One 5X RT MasterMix (ABM). Primer Express 3.0 software was used for designing primers for gene expression analysis by quantitative real-time polymerase chain reaction (Table S4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Cell Biology 2023Quote: The immortalized (SV40) human microglial cell line was acquired from ABM. Human microglial cells were cultured in cell culture flasks coated with 50 μg/ml rat tail collagen I (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the PCR mycoplasma detection kit (ABM, Cat. G238).
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were then treated for 48h with α-syn-HA adenovirus (Applied Biological Materials) at concentration of 2 x 105 IFU/PFU (infectious unit)/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... in combination with the EvaGreen 2x qPCR MasterMix - iCycler (Applied Biological Materials). The primers used to detect the transcripts are listed in Table S1 ...
-
bioRxiv - Physiology 2023Quote: Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... or BrightGreen Express MasterMix (ABM) with custom-designed primers (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... All lines were routinely tested for mycoplasma infection (#G238, Applied biological Materials, Ferndale, WA).
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies (company, cat no.) were used in Western blot experiments: mouse anti-beta-actin (ABM, #G043), mouse anti-Flag (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rabbit polyclonal to HA tag (Applied Biological Materials Cat# G166, RRID:AB_2813867). The Rabbit monoclonal to phospho-Smad 1/5 (Cell Signaling Technology Cat# 9516 ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized from 500 ng total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biological Materials Inc). qRT-PCR was performed using an Applied Biosystems StepOne Plus qPCR instrument with SYBR™ Select Master Mix according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: We implemented an extension of the agent-based model (ABM) found in (30) ...
-
bioRxiv - Cell Biology 2023Quote: Two guide RNAs (gRNAs) (Target_1-318: CGTCTCTCTTGCACGCCGAA; Target_2-442: CGGGTCAGCAAGACGCCCCG) were obtained from Applied Biological Materials and separately cloned into pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro to increase the chances of generating a KO line ...