Labshake search
Citations for Applied Biological Materials :
351 - 400 of 494 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: We simulated an agent-based model (ABM) of honey bee nectar foragers with inter-individual variation in the probability and intensity of their recruitment behaviour ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titer was determined with an ABM qPCR Lentivirus Titration Kit (ABM, Vancouver, B.C., Canada). Titers were 106-107 infectious particles/mL.
-
bioRxiv - Neuroscience 2021Quote: The first cohort consisted of 14 participants that dynamically switched between a 2-back working memory (WM) task and an autobiographical memory (ABM) retrieval task ...
-
bioRxiv - Neuroscience 2021Quote: ... The two distinct block types (ABM and WM) were predicted to activate the DMN and CEN respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... up to a maximum of 4 runs (64 blocks - 32 ABM, 32 WM). The two distinct block types (ABM and WM ...
-
bioRxiv - Cell Biology 2021Quote: Puromycin selectable CRISPR lentiviruses were obtained commercially from Applied Biological Materials. Three different CRISPR lentiviruses were tested for each target gene ...
-
bioRxiv - Biochemistry 2021Quote: ... probed with anti-His (Applied Biological Materials Inc, Richmond, Canada) and Streptavidin-HRP (ThermoFisher Scientific) ...
-
bioRxiv - Systems Biology 2021Quote: ... This process (20 sets of initial guesses × 10 ABM runs × 100 generations) was repeated 30 times ...
-
bioRxiv - Microbiology 2021Quote: The titer of the virus preparations was determined by using the qPCR lentivirus titration kit (Applied Biological Materials, USA) as per the manufacturer-recommended protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell were maintained in Prigrow III medium (ABM), 10% FBS (Sigma) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... The cell suspension was then diluted in StemFlex with ROCK inhibitor to a concentration of 1e6 cell/mL and mixed with 50uL aliquots of both tetO-ALN-PuroR and pUBIQ-rtTA viruses tittered at an estimated 1 × 107 IU/mL using a qPCR Lentivirus Titration Kit (Applied Biological Materials, #LV900). hiPSCs were plated on Matrigel-coated plates and incubated at 37°C with virus overnight ...
-
bioRxiv - Biophysics 2021Quote: ... The products obtained from the X and C region pull-downs were PCR-amplified using the same primers used for their production (see above) and amplicons visualized with agarose gels and SafeView→ (Applied Biological Materials Inc., Vancouver) staining under UV light.
-
bioRxiv - Cancer Biology 2021Quote: ... High Titer cell immortalization kit (Applied Biological Materials, cat. no. LV613; www.abmgood.com), per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... (Applied Biological Materials Inc, Canada) to facilitate differentiation into myotubes50 ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Microbiology 2021Quote: ... free by testing using the ABM Mycoplasma PCR Detection Kit (G238, Applied Biological Materials Inc., Canada).
-
bioRxiv - Neuroscience 2021Quote: ... Site-directed mutagenesis was performed by Applied Biological Materials Inc ...
-
bioRxiv - Biophysics 2021Quote: ... stochastic agent-based model (ABM). Our purpose is to use this modeling framework to encode and test several hypotheses regarding the biophysical interactions between protein cluster and the flowing actin cortex ...
-
bioRxiv - Biophysics 2021Quote: ... obtained from the simulations of the agent-based model (ABM; histograms) match the kernel density estimates of distributions obtained from Monte-Carlo (MC ...
-
bioRxiv - Biophysics 2021Quote: ... We show the probability densities of the x-component of the cluster displacements obtained from ABM simulations as a normalized histogram ...
-
bioRxiv - Biophysics 2021Quote: ... We refer to this method as the “agent-based model” (ABM). The second method is more efficient and is based on Monte-Carlo (MC ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector, Applied Biological Materials #mh10276). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: Real-time PCR was performed for miR-21-5p in A2780R cells infected with lentivirus from Zip control (pLenti-III-miR-GFP control vector from Applied Biological Materials #m001) or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... directly upstream of 24 MS2 repeats and a yellow reporter gene by Applied Biological Materials (Richmond, BC, Canada). We defined kni_-5 as chr3L:20699503-20700905(–) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNAs targeting MED1 were purchased from Applied Biological Materials (Abm ...
-
bioRxiv - Microbiology 2021Quote: ... As negative control we used a scrambled sgRNA sequence: GCACTCACATCGCTACATCA (Applied Biological Materials, Richmond, BC, Canada). MIF-ko-5:CACCGAGCTCGGAGAGGAACCCGTC and MIF-ko-3 ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells used in this work were confirmed mycoplasma-free using the Mycoplasma PCR Detection Kit (Applied Biological Materials G238) according to manufacturer’s instruction.
-
bioRxiv - Genomics 2021Quote: ... HCAE and HCE cells were maintained in PriGrow I and III (ABM), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... Stocks of Lenti-Control and Lenti-NICD3 were titrated by qPCR (catalog number LV900, ABM® good, Richmond, BC, Canada) and their infectivity confirmed by flow cytometry via quantification of GFP+ cells ...
-
Myofiber injury induces capillary disruption and regeneration of disorganized microvascular networksbioRxiv - Physiology 2021Quote: ... and an audible baseline monitor (ABM-3 ...
-
bioRxiv - Cell Biology 2021Quote: ... The absence of Mycoplasma contamination was verified for all cell lines using a sensitive PCR based detection kit (ABM: G238).
-
bioRxiv - Cell Biology 2021Quote: ... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... The production of lentiviral particles up to 109 IU/ml was purified by Ultra-Pure Lentivirus purification kits (Applied Biological Materials Inc. Vancouver). AAV preparation ...
-
bioRxiv - Cell Biology 2021Quote: ... 30 μL of 1mg/mL sulfo-SANPAH dissolved in milliQ H2O was added to PAAm gels which were irradiated under a 365nm UV lamp (ABM, USA) for 5 min ...
-
bioRxiv - Biochemistry 2021Quote: HEK293 Expressing Rpn11-HTBH (Applied Biological Materials, T6007)
-
bioRxiv - Cancer Biology 2021Quote: ... COL-hTERT (Immortalized Human Colon Cells) were purchased from ABM. TM31 were obtained from RIKEN BioResource Research Center ...
-
bioRxiv - Physiology 2021Quote: ... cells were infected using Lenti-SV40 (ts58 temperature sensitive mutant, 106 IU/mL, LV629, Applied Biological Materials) Lentivirus to achieve temperature sensitive immortalization ...
-
bioRxiv - Biophysics 2021Quote: ... N72C and S93C btuB mutants were custom produced by Applied Biological Materials Inc ...
-
bioRxiv - Immunology 2021Quote: ... Pig aortic endothelial cells (PAOC) immortalized with SV40 were purchased from ABM (catalog # T0448). Human CD47 (hCD47 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were visualized in agarose gel using a DNA fluorescent intercalator Safe-Green (ABM, USA) through electrophoresis.
-
bioRxiv - Microbiology 2021Quote: ... Equal amount of RNA was converted into cDNA using First Strand cDNA synthesis kit (Applied Biological Materials Inc.). The cDNA thus obtained was used for SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were co-transfected with CMPK2 siRNA plasmid (Applied Biological Materials Inc, Richmond, Canada), packaging plasmid (pCMV-dR8.2 ...
-
bioRxiv - Immunology 2021Quote: SIMCoV1 is an Agent Based Model (ABM) where space is represented by a discrete Cartesian grid ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus titers were measured by using the qPCR Lentivirus Titer Kit (Applied Biological Materials, China).
-
bioRxiv - Cell Biology 2021Quote: ... chicken polyclonal antibodies to GFP (Applied Biological Materials G160, 1:1000); and human anti-ACA antibodies (Immunovision HCT-0100 ...
-
bioRxiv - Cell Biology 2021Quote: ... along with 3rd generation lentiviral packaging mix from ABM Good ...
-
bioRxiv - Cell Biology 2021Quote: GFP tagged vectors for the 15 hits were obtained from ABM Good (Richmond ...