Labshake search
Citations for Bio-Rad :
2001 - 2050 of 2175 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA obtained was analyzed by quantitative polymerase chain reaction (qPCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). The PCRs were performed in 20 µl reaction volumes that included 50 mM Tris–HCl (pH 8.6) ...
-
bioRxiv - Genetics 2023Quote: ... Putative genomic deletions in the Fo-w and Fo-cn knockout lines were evaluated by amplifying 12 ng of gDNA in 50 μl PCR reactions using a C1000 Touch Thermal Cycler (BioRad, Berkeley, CA). All reactions were carried out to the manufacturer’s recommendations using Ex Taq polymerase (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µL reaction mixes containing 100 ng template RNA were added to a 96-well PCR plate (Bio-Rad Cat. No. MLL9601) and sealed with adhesive Microseal ‘B’ PCR Plate Sealing Film (Bio-Rad Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR reaction mixtures were set up according to the manufacturer’s instructions (Blue S’Green, Biozym, DE) and reactions were carried out on a CFX96™ Touch thermocycler (Bio-Rad, CA, USA). As a control for contamination with genomic DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Microdroplet generation was performed by adding 20 µL of the reaction mixture and 70 µL of droplet generation oil to the DG8™ cartridge (Bio-Rad), covered with a Droplet Generator DG8 TM Gasket (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... The synthesis of cDNA and subsequent amplification was performed in max volumes of 20 μL per reaction using the T100 Thermal Cycler (Bio-Rad, USA). Thermocycle conditions were as such ...
-
bioRxiv - Immunology 2023Quote: ... First-strand cDNA was synthesized from 200 ng of total RNA in a 20 μl reaction using the iScript™ cDNA Synthesis Kit (Cat#: 1708891, Bio-Rad). A SYBR green real-time PCR kit (Cat# 001752A ...
-
bioRxiv - Cancer Biology 2022Quote: Droplet digital polymerase chain reaction (ddPCR) was performed using whole-slide FFPE extracted DNA on a QX200 Droplet Digital PCR System (BioRad, Hercules USA) following previously described protocols [20 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 20 ng of cDNA (based on the original RNA concentration) were used for qPCR analysis in 10 ul reactions with SYBR Green (Bio-Rad, 1725124). Expression was calculated relative to the geometric mean of the two housekeeping genes.
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was added to a reaction mix (20 μL final volume) containing gene-specific primers and SYBR Green Supermix (Bio-Rad, 1725271). All samples were run in duplicates in LightCycler 480 II (Roche) ...
-
bioRxiv - Bioengineering 2023Quote: The gene abundance of total bacteria and nitrifiers were determined by the quantitative polymerase chain reaction (qPCR) using the CFX real-time PCR detection system (Bio-Rad, USA). The primer sets chosen for AOB ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR (RT-qPCR) reactions were performed in triplicates on the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). After an initial period of 3 min at 95 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and Real-time quantitative PCR (RT-qPCR) reactions were carried out were performed in triplicate using CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) or ABI 7500 Fast Real Time PCR System (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... we collected the supernatant in a new 1.5 ml reaction tube and determined the protein concentration of each sample by a Bradford protein assay (Biorad, Cat. No.: 5000006). For each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... gene specific primers were used in an amplification reaction with BlasTaq 2X qPCR Master Mix (abm, Canada, #G892) on a BioRad CFX384 Real Time PCR System (Bio-Rad, USA). Data were analyzed with CFX Manager software (Bio-Rad ...
-
A comparative analysis between two flax varieties indicates lignan-mediated salt stress adaptivenessbioRxiv - Plant Biology 2024Quote: ... cDNA was synthesised from total RNA using the C1000 thermal cycler with a dual 48/48 fast reaction module (Bio-Rad, USA). An equal volume of total RNA (326 ng ...
-
bioRxiv - Cell Biology 2024Quote: ... The reverse transcription reaction was performed using iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, Inc. Hercules, CA, US). Obtained cDNA was processed for quantitative real-time reverse transcriptase PCR for FSHR gene (forward primer CTCACCAAGCTTCGAGTCATCCAA and reverse primer AAGGTTGGAGAACACATCTGCCTCT28 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription followed by qPCR was performed in the same reaction using the Universal Probes One-Step PCR kit (Bio-Rad Laboratories) and the TaqMan primers ...
-
bioRxiv - Microbiology 2024Quote: ... and Cryptosporidium parvum was optimized using SYBR Green fluorescent dye in 25 µL reaction volumes containing 12.5 µL of SYBR SsoAdvanced SYBR Green Supermix (BioRad Laboratories, Hercules, CA), 5.5 µL of sterile milliQ water ...
-
bioRxiv - Microbiology 2024Quote: ... in 25 µl of reaction buffer in a MyiQ™ Single-Color Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA). Reaction conditions were 95°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction mixture in each sample consisted of 12 µL of 2x Supermix for Probes (No dUTP) (Bio-Rad, cat.no.1863023), 1.2 µL of each primers/probe mixture (Prime-Time Std qPCR assay (500 reactions) ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR was performed in 10 µl reactions containing 5 µl SsoFast EvaGreen Supermix with Low ROX (Bio-Rad; item # 1725211) diluted 1:2 ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was then used for quantitative Polymerase Chain Reaction (qPCR) using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) with the pair of primers for mouse Hypoxanthine-guanine phosphoribosyltransferase (mHprt ...
-
bioRxiv - Plant Biology 2024Quote: ... The qPCR reaction was carried out on 2μL of 1/5-diluted cDNA using 2X SSoAdvance SYBR Super Mix (Bio-Rad, Hercules CA) with locus-specific primers (Table S2).
-
bioRxiv - Genomics 2024Quote: RT-qPCR reactions of 12.5 ng DNase-treated RNA were prepared using the iTaq™ Universal SYBR® Green One-Step Kit (Bio-Rad) and run on the Bio-Rad CFX Opus 384 Real-Time PCR System ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was then passed through a P6 Micro Bio-Spin chromatography column (Bio-Rad, 1,000 x g, 4 min, rt), to give the labelled oligonucleotide at ∼500 nM ...
-
bioRxiv - Bioengineering 2024Quote: ... The real-time amplification reactions were performed using a CFX96 Touch Real-Time Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). EvaGreen intercalating dye was supplied by Syntol JSC (Moscow ...
-
bioRxiv - Biochemistry 2024Quote: ... The primer sequences for detecting ACTB are 5’-GACCTGACTGACTACCTCAT-3’(forward) and 5’-TCTCCTTAATGTCACGCACG-3’ (reverse) Quantitative PCR (qPCR) reactions were conducted using the SYBR green PCR master mix (Bio-Rad, 1725121) in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... The reactions were initiated by adding ATP to a final concentration of 1 mM and incubated in a thermocycler (Bio-Rad T100) at 30°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The decorated DNA origami products were purified using agarose gel electrophoresis and Freeze N’ Squeeze DNA Gel Extraction Spin Columns (#7326165; Bio-Rad Laboratories, Hercules, CA, USA), immediately followed by dialysis with Folding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was stopped with 1N sulfuric acid and absorbance was measured at 450 nm in the iMark™ Microplate Absorbance Reader (Bio-Rad).
-
bioRxiv - Evolutionary Biology 2021Quote: ... and these values were converted to metabolite concentrations (in mM) using organic acid and sugar standards (from BioRad or made in-house). Citrate ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The samples were run with 10 mM sulfuric acid at 0.6 mL/min flow rate on an Aminex HPX-87H (Biorad Inc., CA, USA) column at 50°C ...
-
bioRxiv - Immunology 2021Quote: ... the enzyme reaction was stopped with 50 μL of 1 M sulfuric acid per well and the absorbance was measured in Bio-Rad Model 550 microplate reader (Bio-Rad Laboratories). Sera were assayed in duplicates and antibody titer represents the last reciprocal serum dilution above blank.
-
bioRxiv - Molecular Biology 2024Quote: ... 10% (v/v) acetic acid) and imaged using the Molecular Imager Gel Doc XR System and the Quantity One Software Package (Bio-Rad, Germany), or they were used for immunodetection ...
-
bioRxiv - Molecular Biology 2023Quote: The interaction between nucleic acids (ligands) and the proteins (analytes) were measured by the surface plasmon resonance (SPR) technique using a ProteOn XPR36TM (Bio-Rad Laboratories). NLC Sensor chips precoated with NeutrAvidin (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were collected and stored at −80°C for subsequent analysis of total protein content using a bicinchoninic acid (BCA) assay (Bio-rad, # 5000001). Following the lavage ...
-
bioRxiv - Biophysics 2021Quote: ... A standard lane containing a small amount of the DNA substrate used in the packaging reaction allowed for quantification of packaged DNA using the Gel ChemiDoc MP imaging system (Bio-Rad, Hercules, CA). In the DNA packaging experiments involving doping with inactive subunits ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-Time reactions were performed in triplicates using KAPA SYBR FAST qPCR Kit (2X) on QuantStudio 5 Real-time PCR system (Bio-Rad, CA, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Developmental Biology 2021Quote: ... qRT-PCR was performed on 96-well optical reaction plates with one-step SYBR Green PCR master mix (Bio-Rad Laboratories, Cat#1725150).
-
bioRxiv - Microbiology 2021Quote: ... Partitioning of the reaction mixture into up to 20,000 individual droplets was achieved using a QX200 dPCR droplet generator (Bio-Rad Laboratories, Munich, Germany). A two-step PCR-reaction was performed on a Mastercycler Pro instrument (Eppendorf ...
-
bioRxiv - Systems Biology 2021Quote: ... RT reactions were performed in raw or purified HA-bmp2b mRNA and purified embryos mRNA using iScript™ Reverse Transcription Supermix (Bio-rad, # 1708840), followed by digital PCR with TaqMan hydrolysis probes using the QX100TM Droplet Digital PCR System ...
-
bioRxiv - Plant Biology 2020Quote: ... and the quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the iScript™ One-Step RT-PCR Kit (Bio-Rad®), marking with SYBR® Green (Bio-Rad®) ...
-
bioRxiv - Genomics 2021Quote: ... The ddPCR reaction was prepared with ddPCR supermix for probes (No dUTP) and droplets were generated on the QX200 droplet generator (Bio-rad, Hercules, CA). The PCR was run using a Bio-RAD PCR machine and the fluorescence intensity was measured using QX200 droplet reader ...
-
bioRxiv - Microbiology 2021Quote: Droplet Digital PCR (ddPCR) via the Bio-Rad QX200 platform used 20 µl reactions with 10 µl 2x QX200 ddPCR EvaGreen Supermix (Biorad, Hercules, CA, US), 0.4 µM of forward and reverse primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative polymerase chain reaction (qPCR) was performed with specific primers (Supplementary Table 2) using the iTaq™ Universal SYBR® Green Supermix (Bio-Rad) and CFX ConnectTM Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR reactions were performed on the resulting cDNA using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad, USA) and SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 μg total RNA was reverse transcribed into cDNA in a reaction volume of 20 μl using the iScript™ Advanced cDNA Synthesis Kit (Bio-Rad, 1725038). Real-time PCR reactions were performed on the resulting cDNA using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Reverse Transcription (RT) was performed with 2 µg RNA per 40 µl reaction mixture using iScript Reverse Transcription Supermix (Bio-Rad #170-8891). RT-qPCR was performed using primers antibodies (Key Resources Table) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) reaction system on the CFX96 Real-Time detection system (Bio-Rad, CA, USA). Each experiment was performed with three technical replicates and the UBQ10 was used as the endogenous control for data analysis.