Labshake search
Citations for Bio-Rad :
8051 - 8100 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Thirty micrograms of total protein were subjected to SDS-PAGE on a 10% gel in reducing conditions and transferred to PVDF membranes (Bio-Rad). To block nonspecific interactions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were washed 3 times for 10 min with TBS-T and developed with an enhanced chemiluminescence (ECL Bio-Rad 1705061) substrate ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were split and electrotransferred using 4-20% Mini-PROTEAN TGX Stain-Free Protein Gels and the PVDF membrane Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... ten micrograms of proteins were separated by SDS-PAGE and transferred onto 0.2 μm PVDF membranes (Bio-Rad Laboratories, Inc., 1704156) using the Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:5000 dilution in 10% milk) the membranes were imaged as described above but using Clarity Max ECL Western Blotting Substrate (BioRad, 1705062).
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were then incubated with respective primary and secondary antibodies before image acquisition using the ChemiDoc MP imaging system (Bio-Rad). Densitometry analysis was conducted using ImageJ and protein expression levels were normalized to α-tubulin loading control.
-
bioRxiv - Microbiology 2024Quote: Cell lysates were resolved on 7.5 or 4–15% Mini-PROTEAN and Criterion TGX SDS- PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes using a Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked with 5% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... Each gel was transferred to a methanol-activated Immobilon-FL PVDF membrane (MilliporeSigma) which was then UV-activated and imaged for total protein content on a Chemidoc MP (Bio-Rad). Membranes were blocked at room temperature for 1 hr in a 1:1 mixture of PBS and fluorescent blocking buffer (Rockland Immunochemicals ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.02% SDS (w/v)] for 15 min and transferred at 100 V onto a nitrocellulose membrane in a liquid transfer system (MiniProtean, Bio-Rad). Membranes were blocked in Tris-buffered saline solution (50 mM Tris pH 7.6 ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were revealed using the ChemiDoc Imaging System Bio-Rad and the signals quantified with the Image Lab software (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... The membrane was then washed with TBS-T and chemiluminescence was assessed with the BioRad ChemiDoc MP Imaging System (BioRad, 12003154).
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were separated by SDS-PAGE on 16% acrylamide gels immobilized by transfer to a PVDF membrane (Cat. #1620177, Bio-Rad) using a Trans-Blot Turbo Transfer System (Trans-Blot ®TurboTM ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then transferred to a PVDF membrane using the Trans-Blot® Turbo™ Transfer System (Bio-Rad, Cat # 1704150). Membranes were blocked using 5% non-fat milk powder diluted in TBST (Tris-buffered Saline ...
-
bioRxiv - Microbiology 2024Quote: ... and 1.5 µl H2O2 and applied to the membrane before the ECL signal was detected with a ChemiDoc XRS imaging system (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... 500ng of RNA has been diluted in 250 μl of TE low EDTA buffer and applied to pre-equilibrated positively charged nylon membrane (Amersham Hybond-N+ # RPN203B) on Slot blot apparatus (Biorad # 1706542) by gentle vacuum ...
-
bioRxiv - Immunology 2024Quote: ... Proteins lysates were denatured with DTT and boiled prior to separation by SDS-PAGE and transferred onto PVDF membranes (Bio-Rad). Primary antibody incubations (Supplementary Table 2 ...
-
bioRxiv - Physiology 2024Quote: ... Protein was transferred to a methanol-activated PVDF membrane (IPFL85R, sigma) at 30 V overnight at 4°C (1703930, Bio-Rad). The membrane was then washed with 1x TBST with 2% SDS ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were transferred to a methanol-activated PVDF membrane (IPFL85R, sigma) at 300 mA for 90 min at room temperature (1703930, Bio-Rad). The membrane was washed with 1x TBS for 5 min ...
-
bioRxiv - Biophysics 2024Quote: ... Samples were separated on either 8% or 15% SDS-PAGE gels and transferred to nitrocellulose membranes using a Western blot apparatus (Bio-rad). Running buffer composition was 190 mM Glycine ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were separated by electrophoresis at 120 Volts for 1.5 h and then electroeluted onto a PVDF membrane (BIO-RAD, #10026933) at 25 Volts ...
-
bioRxiv - Immunology 2024Quote: ... and then blotted to PVDF membranes using a 20% methanol pre-wet type blotting system and Criterion Blotter with Plate Electrodes (Bio-Rad). Membranes were washed with TBST (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples from the co-IP and were separated on 8% SDS-PAGE gels for 1 h at 120 V and transferred overnight at 20 V on to PVDF membranes (Bio-Rad). Blots were probed with rabbit anti-NMIIB/Myh10 (1:2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were boiled for 5 min and 20 to 30 μg of protein were separated by SDS–polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked in 3% milk in Tris-buffered saline with 0.1% Tween 20 (TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... Then membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (goat anti-rabbit IgG-HRP, 1:10 000, Bio-Rad, # 170-6515 ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were washed again with TBST buffer (5X5 min) and developed using the Clarity Western ECL substrate (Bio-Rad, product #1705061). Images were captured on a luminescent image analyzer (ChemiDocTM MP imaging system ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were washed in PBS-T and developed for 2 min with ClarityTM Western ECL Substrate (Bio-Rad, CA, United States). Imaging was performed using a ChemiDocTM MP Imaging System with Image LabTM software (Bio-Rad ...
-
bioRxiv - Biophysics 2024Quote: ... were separated on a 5-20% polyacrylamide gels (SuperSep Ace, Fujifilm Wako) and transferred onto a polyvinylidene fluoride (PVDF) or nitrocellulose membrane (Bio-Rad) using a Trans-Blot Turbo semi-dry transfer system (Bio-Rad) ...
-
bioRxiv - Genomics 2024Quote: ... The membrane was washed thrice with 1X PBST for 10 minutes each and developed using Clarity-max chemiluminescent HRP substrate (BIO-RAD) using the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: ... The samples were separated using 8% SDS PAGE gels and then transferred onto a nitrocellulose membrane using standard Western blot apparatus (Bio-Rad). Kv1.2 was detected using a mouse monoclonal Kv1.2 antibody (1:10,000 dilution ...
-
bioRxiv - Bioengineering 2024Quote: ... 20ug of protein lysate were loaded and separated on a 10% polyacrylamide gel and subsequently transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad). Membranes were blocked in either 5% bovine serum albumin (BSA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Then the proteins were separated on a 7.5% SDS-polyacrylamide gel and electrotransferred to a PVDF membrane at 120 volts for 70 min using a Mini Trans-Blot device (Bio-Rad). To block nonspecific binding ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein samples were separated by SDS-PAGE electrophoresis and then transferred to nitrocellulose membranes using Trans-Blot Turbo Transfer System (Bio-Rad), followed by incubation with primary antibodies ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes were washed again with TBS-T three times and chemiluminescence was expressed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo) Membranes were imaged on ChemiDoc Touch Imaging System (Bio-Rad).
-
bioRxiv - Cancer Biology 2024Quote: ... Equal amounts of protein were used for gel electrophoresis and blotted on a nitrocellulose PVDF membranes (Mini-PROTEAN system, Bio-Rad). Membranes were cut to allow independent incubation with antibodies for 60-90 min or overnight ...
-
bioRxiv - Biophysics 2024Quote: ... Aliquots of 9 - 18 µg of total protein were separated on polyacrylamide SDS gels and then transferred to polyvinylidene difluoride (PVDF) membranes using Transfer Packs (Bio-Rad). The FLAG-tag fused to MrpG was detected by mouse Anti-DYKDDDDK Antibody (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein samples were resolved by SDS-PAGE according to standard protocol and transferred onto 0.45 μm nitrocellulose membranes (Bio-Rad, 1620115). The membranes were blocked with 1%∼5% milk in TBST (Tris buffered Saline with 0.1% Tween-20 ...
-
bioRxiv - Cell Biology 2024Quote: 50µg of whole cell lysates and 5µl of acid extracts were separated on precast Bis-Tris protein gels (Bolt Bis-Tris Plus gels) and transferred to PVDF membranes (Bio-rad). Rabbit polyclonal antibodies against CTCF (Cat#2899S) ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal amounts of proteins were loaded onto SDS-PAGE gels (range between 8-13% based on the molecular weight of proteins analyzed) and transferred onto PVDF membranes (10600021; Cytiva) using a TurboBlot (1704150; Bio-Rad) semi-dry transfer apparatus.
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were resolved in 1x Laemelli reducing buffer by SDS-PAGE electrophoresis and transferred to a Nitrocellulose blotting membrane (Bio-Rad). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... transferred to a nitrocellulose membrane (Cytiva) for 2 h (at 30V) and detected using infrared light on a Chemidoc MP (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of protein (10-20 µg) were resolved by 8% SDS–PAGE gels and transferred onto polyvinylidene fluoride membranes (Bio-Rad). The membranes were blocked in 4% (wt/vol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Twenty micrograms of extracted protein were loaded onto SDS-PAGE gels (10%) and transferred to a polyvinylidene difluoride membrane (PVDF) (Bio-Rad). Blocking was undergo using 5% fat-free milk powder ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein sample was separated by SDS-PAGE and then transferred to a 0.22 μm nitrocellulose membrane (Bio-rad, catalog #1620097). The membrane was blocked in 5% skim milk overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was then washed 3x in PBS-T and the signal was developed using Clarity Western ECL Substrate (Bio-Rad). The mouse anti-alpha tubulin antibody (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were wet-transferred onto a 45 µm pore size Immun-Blot® LF PVDF membrane (Bio-Rad, cat. 162-0260) in methanol transfer buffer (25 mM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: Protein concentration was estimated using DC protein assay as mentioned in the manual (Bio-rad Inc., 500-0116). 100 μg of total protein was resolved on 10 ...
-
bioRxiv - Cell Biology 2020Quote: ... Gaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattct gcagacaaatggcagtattcatccacaattttaaaagaaaagggggg (FAM) The house keeping probe used for comparison was EiF2C1 (Assay ID: dHsaCP2500349 Cat: 10031243, BioRad).
-
bioRxiv - Genetics 2021Quote: ... to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2021Quote: qPCR was performed using an EvaGreen (dye-based) assay on a CFX96 Touch Real-Time Thermocycler (Bio-Rad). Reactions were assembled using 2× SsoFast EvaGreen Master Mix (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Calcium levels were normalized to protein levels measured using the Bradford assay (Bio-Rad Laboratories, Hercules, CA, # 5000006).