Labshake search
Citations for New England Biolabs :
5101 - 5150 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were amplified out of cDNA from Arabidopsis Col-0 or an SICp:SICm-Venus-HA transgenic line (see below) by PCR with Q5 High Fidelity Polymerase (New England Biolabs, www.neb.com). Primers “WARP2cdsGATEF” and “WARP2cdsR” were for SIC and primers “DBR1_CDS_nostp_CACC_F” and “DBR1_CDS_stp_R” were for DBR1 (Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: The extracted DNA was used as a template to amplify the variable region by a two-step PCR strategy using a high-fidelity DNA polymerase (NEBNext ultra II Q5 master mix, M0544L, NEB). The first PCR of 22-24 cycles was performed using primers #232 to #273 (Table S9 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR amplicons were run by electrophoresis on a 2% agarose gel to ensure the absence of primer-dimers and PCR samples for each primer pair-opsin target were purified using Exonuclease (EXO) and Shrimp alkaline phosphatase (SAP) (NEB) prior to Sanger Sequencing to confirm gene-specific amplification ...
-
bioRxiv - Genetics 2023Quote: ... The primers contained 60 bases pairs of homologies for the downstream and upstream region of the arcZ gene as well as homology with the kanamycin resistance gene (ArcZkanfor and ArcZkan) PCR was carried out with the Q5 2X Master Mix (New England Biolabs). The mixture was run in the thermocycler with a denaturation temperature of 95°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotypes for SNVs were determined by restriction digestion of its PCR products with suitable enzymes (New England Biolabs Inc, Ipswich) following manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 kb of genomic DNA upstream of the TgAPT1 stop site was amplified by PCR using Q5 high fidelity polymerase (New England BioLabs) using the Ku80 genomic DNA as a template and the primers TgAPT1 F1 and TgAPT1 R1 (Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... The mWasabi sequence under the control of the constitutive Pleft* promoter45 was amplified by PCR using a Q5 high-fidelity DNA polymerase (New England Biolabs). Plasmids were linearized with KpnI-HF (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ddc2-CC (residues 1-148) fragment was PCR amplified from yeast cDNA library with Phusion polymerase and digested with BamHI-XhoI (NEB) restriction endonuclease ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2023Quote: ... to pcDNA4/TO and PiggyBac-CMV-MCS-IRES-mCherry and PiggyBac-CMV-MCS-IRES-mNeongreen by PCR using Q5 High Fidelity 2X mastermix (NEB). PiggyBac-CMV-MCS-IRES-NLS-TagBFP was used as empty vector control ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene fragments encoding TwCel5CAT and TwCel5CBM were generated using through PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and the primers described in Table S1 ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cell Biology 2023Quote: ... generated by randomly primed DNA synthesis using an 800 bp PCR product overlapping with the 1394 bp restriction fragment as a template and Klenow polymerase (NEB). Telomeric restriction fragment analysis was carried out as previously described (Nandakumar et al. ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing the sgRNA sequences were resuspended at 100 nM in H2O and amplified by PCR using HF Phusion polymerase (New England Biolabs). After verifying amplification on a 10% acrylamide gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... The point mutations G729E and G719F were introduced into the EGFR-WT expression vector by PCR using Phusion high fidelity DNA polymerase (New England Biolabs). PCR product obtained was digested by methylation-specific enzyme DpnI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The six PCR products were then inserted into the ClaI-digested plasmid in a single reaction with NEBuilder (NEB, #M5520AA). All cloning products were verified by control restriction digestion and Sanger sequencing ...
-
bioRxiv - Genomics 2022Quote: ... was PCR amplified (495bp) and cloned into the Lucia vector (Supplementary Figure 4) using ApaI and BamHI restriction enzymes (NEB, Catalog no ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were gel-purified and then assembled into a plasmid backbone digested with MluI (New England BioLabs, R3198S) and SpeI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... Large dsDNA donor molecules with ∼40 bp homology arms on each end were prepared by PCR using Q5 DNA Polymerase (New England BioLabs) and purified using HighPrep PCR Clean-up beads (MagBio ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... primers 972 and 973 were designed to amplify the fragment by PCR with Q5 polymerase and high-GC buffer (NEB). The barcode fragment and pKS1 were both digested with NcoI and BamHI and ligated with T4 DNA ligase (NEB ...
-
bioRxiv - Systems Biology 2023Quote: ... The DpnI-treated linear plasmid backbones were then mixed with the relevant PCR amplified tile and assembled by in vitro recombination with the NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). The assembly reactions were purified ...
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Biochemistry 2023Quote: Site-directed mutagenesis of StCphA2 was by performing PCR reactions with 10 ng template in Phusion® HF buffer (NEB), 0.2 mM of each dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 ng of DNA was inputted into a first round of PCR (27 cycles, Q5 hot start high-fidelity DNA polymerase (New England Biolabs)) to attach common overhangs and amplify the target locus ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR fragments were assembled using NEBuilder® HiFi DNA Assembly Master Mix (Cat. No. E2621, NEB, Ipswich, MA, USA). DNA sequences in all these plasmids were authenticated by automatic sequencing.
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids purified from both t0 and t24 samples were amplified using two rounds of PCR with Q5 polymerase (New England Biolabs) to add adapters and indices for Illumina sequencing ...
-
bioRxiv - Genetics 2023Quote: ... via a 20 µL PCR that utilized the following: 10 µL Onetaq Quick-Load 2x master mix (New England Biolabs), 10 µg bovine serum albumin ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Genomics 2023Quote: ... was cloned between residues 34 and 35 with primers ag424 and ag425 using inverse PCR with Q5 polymerase (New England Biolabs, NEB).23 The sequences of all primers used in this study are presented in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Biophysics 2023Quote: HeR-48C12 was amplified from pBAD-Helios-NT-6xHis and combined with TSX3ER2 and Citrine using overlap-extension PCR with Phusion high fidelity master mix (NEB). The primers used for cloning are listed in the Supporting Information (SI ...
-
bioRxiv - Microbiology 2023Quote: ... V3-V4 region of 16S rRNA gene was amplified using specific primers with the barcode and Phusion High-Fidelity PCR Master Mix (New England Biolabs). PCR products were mixed at equal density ratios ...
-
bioRxiv - Bioengineering 2023Quote: ... The digested PCR product and pSubMAAP vector was then ligated together using T4 DNA ligase (New England Biolabs, Ipsiwch, MA), transformed into Top10 competent cells (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragments needed to assemble the constructs encoding GADD34Δ and K3L were PCR amplified using Q5 High-Fidelity DNA polymerase (NEB) from plasmid templates (gift of A ...
-
bioRxiv - Biophysics 2023Quote: ... the annealed mixture was ligated to the dsDNA construct prepared by PCR amplification using T4 DNA ligase (New England Biolabs) at 16°C for 16 h and the ligase was heat deactivated at 65 °C for 20 min ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids encoding RBC biosensor proteins were assembled using standard molecular biology techniques of PCR and restriction enzyme cloning with Phusion DNA Polymerase (NEB), restriction enzymes (NEB ...
-
bioRxiv - Bioengineering 2023Quote: The PCR reaction was performed and the resulting PCR product as well as PCDH-mNeonGreen-MCS-T2A-puromycin plasmid were cleaved with BamH1(NEB) and Not1(NEB ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as the template for PCR with primers containing gene-specific targeting homology arms (1x Q5 Master Mix, New England Biolabs #M0494S ...
-
bioRxiv - Neuroscience 2023Quote: ... The guide RNA target site was amplified from transfected cells and PCR products were analyzed by T7 Endonuclease I digestion (New England Biolabs) or Sanger sequencing followed by ICE analysis (Synthego ...
-
bioRxiv - Systems Biology 2023Quote: A single round of PCR was performed using NEBNext® Multiplex Oligos for Illumina®(New England Biolabs, Ipswitch, MA) that anneal to the Illumina primer binding sites already present in the barcode region of the plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... plasmids and PCR products would be digested with the corresponding restriction enzymes and ligated together with T4 DNA ligase (New England Biolabs). The ligated plasmid would be transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA barcodes were amplified from genomic DNA using universal primers JSW-SS-170 (CGACGCTCTTCCGATCTNNNNN TGATGTCGTTGTTGCCATCG) and JSW-SS-171 (ACTGACGCTAGTGCATCA CTTTCTGAGCCAGTGTTGCT) and the Q5 Hot Start High-Fidelity 2X PCR master mix (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified DNA was then size enriched using 0.9X volume SPRI beads and subject to another round of PCR using 10x cycles with NEBNext Ultra II (NEB M0544S) using primers pairs cTF383+cTF399 for the promoter and oSA021+oSA023 for the gene body to add Illumina Read1 and Read2 overhangs ...
-
bioRxiv - Pathology 2023Quote: ... The region surrounding the desired change was amplified by PCR and subsequently digested with the restriction enzyme DdeI (New Englands Biolabs) to detect positive clones ...