Labshake search
Citations for New England Biolabs :
4051 - 4100 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Reactions were performed using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L) and a CFX Opus 384 Real-Time PCR System (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... NGS libraries were pooled and quantified by qPCR using NEBNext Library Quant Kit (NEB). Sequencing was performed with NextSeq high-output kit with 75/150-cycle single-end reads and automated adaptor trimming and demultiplexing (Illumina ...
-
bioRxiv - Plant Biology 2023Quote: ... The Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Cat # E3005X) and reaction protocol (cycle variations ...
-
bioRxiv - Genetics 2023Quote: ... and NGS libraries were quantified by qPCR using the NEBNext Library Quant Kit (NEB). Illumina sequencing was performed using the NextSeq platform with automated demultiplexing and adaptor trimming (Illumina).
-
bioRxiv - Genomics 2023Quote: ... Samples were further quantified by qPCR using NEBNext Library Quant Kit for Illumina (NEB) and then pooled equimolarly based on estimated concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... The qPCR reaction was performed with Taq DNA polymerase (New England Biolabs, Beverly, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... rAAV titering was performed on crude cell lysates using dye-based qPCR (NEB, M3003L) with primers against ITR regions ...
-
bioRxiv - Genetics 2021Quote: ... All NEBNext reagents are from New England Biolabs (NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB #E6421S). 1x ProNex beads was used to purify the amplified cDNA and eluted to a final volume of 50uL in EB.
-
bioRxiv - Systems Biology 2020Quote: ... we prepared sequencing libraries using the NEBNext single-cell/low-input RNA sequencing library preparation kit for Illumina (NEB) then performed paired-end sequencing of these libraries (38 cycles read 1 + 37 cycles read 2 ...
-
bioRxiv - Genomics 2021Quote: RNA libraries were prepared using an NEBNext Single Cell/ Low-Input RNA Library kit (New England BioLabs, Tokyo, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... we used NEBnext Single Cell/Low RNA Library prep Kit for Illumina to generate sequencing libraries (New England BioLabs). Libraries were sequenced on Illumina NextSeq 500 system (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared using NEBNext® single cell/low input RNA library preparation Kit (New England Biolabs). Library preparation was initiated with 10ng of total RNA ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transcription cDNA synthesis was performed using NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB, E6421). Samples were barcoded and the library pool was prepared according to the guidelines laid out in the Iso-Seq protocol version 02 (PacBio ...
-
PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiationbioRxiv - Developmental Biology 2023Quote: ... Libraries were constructed using NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (NEB, E6420S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The library was generated using a NEBNext® Single Cell/Low Input RNA Library Prep Kit (New England Biolabs). RNAseq was performed using an Illumina NovaSeq 6000 ...
-
bioRxiv - Genomics 2023Quote: ... and then were reverse-transcribed into cDNA using NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB, UK). Sequencing libraries were constructed by SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... low range ssRNA ladder (N0364S) and the Monarch RNA Cleanup Kit (T2030L) were purchased from NEB (Ipswich, MA, USA). T4 DNA ligase (EL0013) ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA samples (500ng) were processed with the “NEBNext Single Cell/Low Input RNA Library Prep” kit (NEB #E6420) by following manufacturer instructions ...
-
bioRxiv - Genomics 2024Quote: ... RNA sequencing libraries were prepared using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB) according to the recommended protocol using 1 ng RNA as input material ...
-
bioRxiv - Genetics 2024Quote: ... Paired-end indexed libraries were prepared using the Sureselect XT Low Input Library prep protocol on the Agilent Bravo liquid handler following the manufacturer’s protocol (NewEngland Biolabs, Ipswitch ...
-
bioRxiv - Microbiology 2021Quote: All PCR assays were carried out in 25 μL total reaction volumes using 2x Mastermix (New England Biolabs Inc., Ipswich, USA), 1.25 μL oligonucleotide primes (10 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Genetics 2020Quote: ... We then eluted the DNA from the beads using 10 μl of water and added to it 25 μl NEBNext HiFi 2x PCR MasterMix (NEB M0541), with 2.5 uL of each of the dual-indexed Illumina Nextera primers (25 μM) ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... with or w/o 500 µM auxin and the same volume of 2x Monarch DNA/RNA Protection Reagent (NEB #T2011-1) was added before snap-freezing and storage at −80°C until RNA extraction.
-
bioRxiv - Genomics 2024Quote: ... of 0.1 μM polyT-rootV2 oligo diluted in hybridization buffer (2x SSC, 1 mg/mL yeast RNA, 10% dextran sulfate, 1:1000 Murine RNase inhibitor NEB M0314) on a parafilm sheet placed on a glass plate ...
-
bioRxiv - Microbiology 2024Quote: ... The 12 μl of size-selected metagenomic DNA fragments were gap-filled by the addition of 12 μl of 2x Q5 DNA polymerase (New England Biolabs, M0492S) (pre-incubated at 98°C for 30 seconds ...
-
bioRxiv - Immunology 2021Quote: ... Deglycosylation was performed on beads using Protein Deglycosylation Mix II (NEB) in denaturing conditions according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 µl Evagreen and 25 µl Q5 PCR mix from NEB ultra II Kit (E7645S ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Add 150 μL of dA-Tailing mix (New England BioLabs E6053L) (131 μL NFW ...
-
bioRxiv - Bioengineering 2019Quote: ... and R701A substitutions were conducted using the KLD Enzyme Mix (NEB) following PCR amplification with mutagenic primers (Genewiz) ...
-
bioRxiv - Systems Biology 2020Quote: ... and 2 μL NEBNext Second Strand Synthesis Enzyme Mix (E6111S, NEB) were added to the purified cDNA ...
-
bioRxiv - Genomics 2019Quote: ... The 60 μL mix contained 6 μL of TAQ buffer (NEB), 3 μL of 5 μM forward primers mix ...
-
bioRxiv - Immunology 2021Quote: ... a mix containing 2 μl of RNAse H (NEB, Cat. #M0297S), 1 μl of E ...
-
bioRxiv - Genetics 2021Quote: ... We injected worms with an injection mix containing Cas9 EnGen (NEB), 4 sgRNAs against mir-1 (AAGAAGTATGTAGAACGGGG ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µl NEB-Next High-Fidelity PCR Mix (NEB, cat # M0541S), 5 µl of SYBR Green (Invitrogen™ ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20µL of digestion mix containing 125U HinfI (New England BioLabs, #R0155M) and 25U RsaI (New England BioLabs ...
-
bioRxiv - Cancer Biology 2019Quote: ... After cooling 5 µl Protein Deglycosylation Mix II (New England Biolabs) was mixed in gently ...
-
bioRxiv - Cell Biology 2020Quote: ... or the LunaScript RT Super Mix Kit (NEB # E3010(S/L), Ipswich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Purified DNA was then treated with additional RNaseA/T1 mix (NEB) for 30 minutes at 37C and then single stranded DNA was isolated from the prep using an ssDNA/RNA Clean & Concentrator kit from Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL NEBNext End Prep Enzyme mix (New England Biolabs, USA), 2.5 µg fragmented DNA and adjusted to 50 µL with nuclease free water (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs), and 48 μL water ...
-
bioRxiv - Immunology 2021Quote: ... The fragments were assembled using Hi-Fi DNA Assembly Mix (NEB). For the DonorgRNA vector ...
-
bioRxiv - Neuroscience 2019Quote: ... sequences below) using Gibson cloning (HIFI assembly mix, New England Biolabs) according to the manufacturers protocol ...
-
bioRxiv - Genetics 2020Quote: ... DNA was pre-treated with FFPE Repair Mix from NEB (M6630S) according to manufacturer’s Protocol for use with Other User-supplied Library Construction Reagents to repair nicks that could result in undesired target degradation by exonucleases.
-
bioRxiv - Genomics 2021Quote: ... The sample mix contained 1 μL RNAse Inhibitor (New England Biolabs), 1× ROX Reference Dye (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All fragments were incubated with Gibson assembly mix (New England Biolabs) as per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... 2) 7 µL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per slide was added for deglycosylation and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were first incubated with Deglycosylation Mix Buffer 2 (NEB) at 75°C for 10 min ...