Labshake search
Citations for New England Biolabs :
4001 - 4050 of 5111 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 μl of 25 mM dNTP mix (NEB, N0447S), and samples were incubated for 3 minutes at 65 °C and transferred to ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed using random primer mix (New England Biolabs) and the Maxima Reverse Transcriptase kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 25 μL of PCR mix (Q5 DNA polymerase (M0491, NEB), 2 mM dNTP ...
-
bioRxiv - Microbiology 2022Quote: ... Gibson assembly relied on the HiFi DNA assembly mix (NEB). All enzymes used in cloning were obtained from NEB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was end-repaired using DNA Repair Mix (NEB E6050L) and shotgun cloned into pWR2700 that had been cut with SmaI (NEB R0141L ...
-
bioRxiv - Genomics 2022Quote: ... 2μL of 10mM dNTP mix (New England Biolabs, Cat. N0447), and 2 μL of 10μM of either the 9-nucleotide random primer (n9 ...
-
bioRxiv - Microbiology 2024Quote: ... The amplicon was treated with KLD enzyme mix (NEB; M0554S) and transformed into competent DH5 alpha E ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µl Ultra II end prep enzyme mix (NEB), and incubated at 20 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl 10× Template Switching RT Enzyme Mix (NEB) were added to the mixture and the reaction was incubated at 42 °C for 90 min followed by 85 °C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2μl random primer mix (New England Biolabs, cat#S1330S) were mixed and incubated for 10 minutes at 23°C then put on ice for 1 minute ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Full-scale libraries were amplified with Q5 enzyme mix (NEB). Libraries were sequenced with a NovaSeq 6000 platform (Annoroad Gene Technology ...
-
bioRxiv - Developmental Biology 2023Quote: ... adaptors (IDT) were ligated using Blunt/TA ligation mix (NEB), and amplified using generic P5 and P7 primers ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of rSAP mix (rSAP (1 U, NEB, M0371L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Immunology 2023Quote: ... The Gibson Assembly reaction mix was transformed in bacteria (NEB Stable Competent Escherichia coli (High Efficiency) ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL NEBNext Ultra II End Prep Enzyme Mix (NEB), and nuclease-free water (NFW) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... then replaced with T7 RNAP mix (New England Biolabs E2040S). The sample was incubated at 37 C overnight in a humidified tupperware.
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (2 μL APOBEC reaction buffer (NEB), 0.4 μL APOBEC (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (2 μL APOBEC reaction buffer (NEB), 0.2 μL APOBEC (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... The mix consisted of 1 µL Cas9 protein (BioLabs, M0369M), 1 µL Fast Green FCF dye (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified RNA was reverse transcribed with Luna Superscript Mix (NEB). RNA transcripts of viral and host genes were measured by quantitative PCR using primers listed in Table 2 and Power SYBR Green kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... We used Template Switching RT Enzyme Mix (NEB, Ipswich, MA), along with a uniquely barcoded oligo(dT)30 primer for each sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... Following the adaptor ligation each sample was mixed with 20 μl of a 2x DpnII Digestion Buffer and 10 units (1 μl) of DpnII restriction enzyme (New England Biolabs) mastermix and were incubated for 3 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... all reactions using capped 25mer RNA substrates were terminated by the addition of 1 volume of 2X RNA loading dye (NEB). The reactions using the m7GpppA dinucleotide cap analog were terminated with the addition of phenol/chloroform.
-
bioRxiv - Microbiology 2019Quote: ... Amplification was performed in a total volume of 25 µl containing 12.5 µl of 2x OneTaq Mastermix (New England Biolabs, NEB), 9.9 µl of nuclease-free H2O ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA-bound beads were again washed twice in 2x Bead Wash Buffer and then washed twice in 1x Cutsmart Buffer (NEB) before being resuspended in 80 µL of 1x Cutsmart Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 8 ug of <200nt RNA per sample was mixed to an equal volume of 2x loading dye (NEB #B0363A) and incubated at 70°C for 5min ...
-
bioRxiv - Molecular Biology 2020Quote: ... We used 5 ng of each plasmid elute as PCR template and amplified out the portion of interest using 0.5 μM of primers annealing to the region of the sgrS sequence under consideration with Phusion 2X Mastermix (NEB, M0531L). We employed 20 cycles of 10 s at 98 °C denaturation ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μl RT mastermix (2x reaction buffer, 20 mM DTT, 4U murine RNase inhibitor [NEB], 30 U ProtoScript II Reverse Transcriptase [NEB]) were added ...
-
bioRxiv - Genetics 2020Quote: ... the ‘T2A-GFP-WPRE’ sequence was amplified from the hVMD2-hBEST1-T2A-GFP plasmid using LCv2-GFP.Gib.F and .R primers and Q5 2X MM (NEB, Cat# M0492L). The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... beads were resuspended in 25 μl 0.5x TT and on bead PCR for addition of Illumina-specific adapters and 10-bp Unique Dual Indexes (UDIs) using NEBNext 2X High Fidelity PCR MM (NEB) and 25 PCR cycles was performed (Figure 5-table supplement 2) ...
-
bioRxiv - Bioengineering 2022Quote: ... HiScribe T7 RNA polymerase kits and Q5 2x HiFidelity PCR mastermixes were purchased from New England Biolabs (NEB, Ipswitch, MA). Sodium cacodylate solution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HDR-donor assemblies were completed using NEBuilder HiFi 2X Mastermix in accordance with the manufacturer’s protocol (New England Biolabs; E2621L). HDR-donor constructs were verified by whole-plasmid sequencing by Primordium Labs (Arcadia ...
-
bioRxiv - Molecular Biology 2022Quote: ... were introduced into the XhoI digested backbone pRRL-EF1a-XhoI-IRES-BlastR with NEBuilder 2x HiFi assembly (New England Biolabs). The assembly mix was purified via isopropanol precipitation and electroporated into Stbl4 bacteria (Thermo Fisher 11635018 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probes were hybridised in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg/μL BSA (New England Biolabs), 10 mM vanadyl-ribonucleoside complex ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tagmented samples were amplified by the addition of 2.5 µL each of 10 µM barcoded forward and reverse primers (Picelli et al., 2014) (Picelli et al., 2014) and 15 µL Q5 2x HiFI MasterMix (New England Biolabs) using the following thermocycling conditions ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2023Quote: ... to pcDNA4/TO and PiggyBac-CMV-MCS-IRES-mCherry and PiggyBac-CMV-MCS-IRES-mNeongreen by PCR using Q5 High Fidelity 2X mastermix (NEB). PiggyBac-CMV-MCS-IRES-NLS-TagBFP was used as empty vector control ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were quenched with the addition of an equal volume of 2X RNA loading dye buffer and 0.8 units of proteinase K from Tritirachium album (New England Biolabs Inc.) were added ...
-
bioRxiv - Genomics 2024Quote: ... The ATAC libraries were amplified for 11 cycles using NEBNext 2X MasterMix and Nextera Index primers (New England Biolabs, # M0541S). The amplified libraries were size selected using AMPure beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library concentration was qPCR measured by NEBNext Library Quant Kit (New England BioLabs) using QuantStudio 5 Real-Time PCR Systems (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... these purified cDNA were also subjected to qPCR (Hot-start OneTaq (New England Biolabs), 1x Standard Taq buffer ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs were performed using the Luna® Universal One Step RT-qPCR Kit (NEB) in a ThermoFisher Quantstudio 3 instrument ...
-
bioRxiv - Developmental Biology 2019Quote: ... Libraries were then quantified by qPCR using NEBNExt Library Quant Kit for Illumina (NEB) on QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and NGS libraries were quantified by qPCR using the NEBNext Library Quant Kit (NEB). Illumina sequencing was performed with a NextSeq mid-output kit with 150-cycle single-end reads and automated adaptor trimming and demultiplexing (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... and Calnexin (membrane) using qPCR primers (IDT) with Q5 polymerase (New England Biolabs, M0492) was measured with a highly sensitive dsDNA detection dye (Lumiprobe ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA first strand synthesis and amplification were performed using Luna Universal qPCR mastermix (NEB) with previously described qPCR conditions on StepOne Plus Real-time PCR System (Applied Biosystems).10 Primer sequences are provided in the supplementary material (Table 1).