Labshake search
Citations for New England Biolabs :
3751 - 3800 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... The PCR product was spin column purified and then digested with BssSI-v2 and PpuMI (NEB R0560) in order to form the 6,481 bp center segment with 4 or 3 bp overhangs on the ends ...
-
bioRxiv - Bioengineering 2023Quote: ... The inverse PCR protocol was adapted from an established protocol (56) utilizing Sau3AI (New England Biolabs®) and HinP1I (New England Biolabs® ...
-
bioRxiv - Microbiology 2023Quote: ... Linearized pExTra01 plasmid was prepared for isothermal assembly reactions via PCR (NEB Q5 HotStart 2X Master Mix) of pExTra01 using divergent primers pExTra_F and pExTra_R ...
-
bioRxiv - Immunology 2024Quote: ... The qRT-PCR assays was performed using Luna Universal qPCR Master Mix (New England BioLabs, Frankfurt, Germany) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories GmbH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Exon 3 of Smad4 was amplified by PCR using the Q5 High Fidelity DNA polymerase (M0491S; NEB). Smad4 primers used were FWD ...
-
bioRxiv - Bioengineering 2024Quote: Primers were synthesized by Thermo Scientific and routine PCR amplifications were carried out using Phusion High Fidelity DNA Polymerase (New England Biolabs, UK). Chromosomal modifications were engineered in A ...
-
bioRxiv - Biochemistry 2024Quote: ... the pSEVA plasmid was amplified by PCR using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the Fwd_GFP_rep_AN (ATGCGTAAAGGAGAAGAACTTTTCAC ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2015) using indexed and non-indexed primers and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541) in a thermomixer with the following program ...
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... PCR reactions to amplify sgRNA and CaCas9 were carried out using Phusion High-Fidelity DNA polymerase (NEB), and Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected cDNA was then PCR amplified for 12 cycles using Q5 High-fidelity polymerase (NEB #M0491S). Amplified libraries were then run on a 6% TBE gel ...
-
bioRxiv - Microbiology 2024Quote: ... amplified plasmid and insert PCR products were assembled using NEBuilder HiFi DNA Master Mix (New England Biolabs) following manufacturer’s protocols and transformed into Escherchia coli strain S-17 by electroporation for maintenance and replication ...
-
bioRxiv - Biochemistry 2024Quote: Cy3-labeled enhancer-promoter DNAs used for condensation assay were generated by PCR using Taq polymerase (NEB) with a Cy3-labeled primer (IDT ...
-
bioRxiv - Genetics 2024Quote: ... Each of the six mutant segments were amplified from the oligonucleotide pool by PCR (Q5, NEB #M0491L), gel purified (QIAEX II Gel Extraction Kit ...
-
bioRxiv - Genomics 2024Quote: ... and used as a template for a two-step PCR with Phusion High-Fidelity DNA polymerase (NEB) and primers in Supplementary Table 7 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR reactions were cleaned up using NEBNext sample purification beads (New England Biolabs GmbH, Frankfurt, Germany). Concentration of the libraries was determined by Qubit using the Qubit dsDNA HS Assay Kit (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was amplified by PCR in 25 μL reactions using Q5® High-Fidelity DNA Polymerase (NEB). All PCR reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... PCR samples were combined with 1 μL of 6X gel loading dye (New England Biolabs, Cat. # B7024S) per 5 μL of sample and loaded each the remaining wells ...
-
bioRxiv - Systems Biology 2024Quote: ... Resulting cDNA was amplified by 19 PCR cycles using LongAmp Hot Start Taq 2X Master Mix (NEB). RT and PCR primers were used as previously described (Rabani ...
-
bioRxiv - Cell Biology 2024Quote: ... Both amplicons were generated through PCR with Q5 Hot Start High-Fidelity 2X Master Mix (NEB #M0494) using primers listed in Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Primer amplicons were generated through PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB #M0494). G-protein-coupled receptors (Ste2 ...
-
bioRxiv - Biophysics 2024Quote: ... A 673 bp digoxigenin-labeled DNA handle was amplified in Q5U PCR master mix (NEB, Cat# M0597L) with a forward primer containing a deoxyuridine and a reverse primer with a 5′ digoxigenin tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the barcode and sensor regions of the biosensor libraries were amplified using Q5 PCR (New England Biolabs) directly off 5 μL of glycerol stock using primers p117 and p118 (Table 2) ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA molecules were purified using a commercially available purification kit (MonarchQR Plasmid Miniprep Kit, NEB). The purified plasmids were run on a 0.8% agarose gel supplemented with 2.5 µg/mL of chloroquine in 1xTBE buffer containing 2.5 µg/mL of chloroquine at 25 V for 15 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... using the Gibson assembly kit (NEB). The pET28b vector was linearized by digesting with BamHI and XhoI to create overhangs compatible for Gibson assembly ...
-
bioRxiv - Biophysics 2020Quote: Using PURExpress kits (New England Biolabs), 37.5 μL IVT reactions were assembled on ice with 1.5 μl RNase inhibitor ...
-
bioRxiv - Microbiology 2020Quote: ... using the NEBuilder HiFi kit (NEB).
-
bioRxiv - Microbiology 2020Quote: ... using the NEBuilder HiFi kit (NEB). The mdtU-lacZ translational fusions were constructed by PCR-amplifying the mdtU gene from either a WT (E ...
-
bioRxiv - Molecular Biology 2022Quote: ... NEBNext rRNA Depletion kit( NEB #E7405) was used to deplete ribosomal RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... using Gibson assembly cloning kit (NEB). COX8A-SNAP vector was commercially obtained from NEB ...
-
bioRxiv - Genomics 2021Quote: ... NEBNext UltraII Q5 kit (NEB M0544) was used for PCR enrichment ...
-
bioRxiv - Microbiology 2021Quote: ... using Monarch Plasmid Miniprep kit (NEB). Sequencing was through the company Genewiz.
-
bioRxiv - Molecular Biology 2021Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used for generating dCas9 plasmids encoding the mutant p300core* (Y1467F ...
-
bioRxiv - Immunology 2022Quote: ... The second strand synthesis kit (NEB) at 16°C for 2 hours was used for cDNA synthesis followed by a 1.4X AMPure XP bead cleanup ...
-
bioRxiv - Cell Biology 2022Quote: ... Q5 site directed mutagenesis kit (NEB) was used and the manufacturer’s instructions were followed.
-
bioRxiv - Biophysics 2020Quote: ... and Q5 Hotstart Mutatagenesis kit (NEB) were used.
-
bioRxiv - Genomics 2022Quote: Monarch Genomic DNA Purification kit (NEB)
-
bioRxiv - Developmental Biology 2022Quote: ... “Q5 Site-Directed Mutagenesis Kit” (NEB) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... using the Gibson assembly kit (NEB) to create pBPGUw-QF2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... HiScribe T7 ARCA mRNA kit (NEB) was used for mRNA synthesis with 10 μl of 2x ARCA/NTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... or Monarch RNA isolation kit (NEB) was used for RNA extraction ...
-
bioRxiv - Immunology 2021Quote: ... end blunting (Quick blunting kit; NEB), and ligation with (T4 ligase ...
-
bioRxiv - Neuroscience 2021Quote: ... NEBNext rRNA Depletion Kit (NEB E6310) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Monarch RNA cleanup kit (T2030L, NEB), Murine RNase inhibitor (M0314L ...
-
bioRxiv - Biophysics 2022Quote: ... using a Gibson Assembly kit (NEB). Full-length Cav1.2 or Cav1.2(ΔC ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The NEBNext Library Quant kit (NEB) was used to quantify the amplicons prior to pooling ...
-
bioRxiv - Cancer Biology 2022Quote: ... Using LunaScript RT Supermix kit (BioLabs), cDNA was prepared in a 20 μL reaction according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The Monarch RNA Cleanup Kit (NEB) was used to purify the resulting RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Q5 site directed mutagenesis kit (NEB) was used to generate various SARS-CoV-2 FSE conformation stabilizing constructs and other length dependent constructs and their sequences were confirmed through sanger sequencing (Eurofins genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... using the HiFi Assembly kit (NEB). NEBuilder Assembly Tool 2.0 was used to design RRM1-2 primers with 21-bp overlap with the destination vector ...